Construct: ORF TRCN0000465668
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011087.1_s317c1
- Derived from:
- ccsbBroadEn_12867
- DNA Barcode:
- TAATGTTGACCACCACCGTGTAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AGBL4 (84871)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465668
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | XM_017002597.2 | 54.2% | 52.1% | (many diffs) |
2 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | NM_001323575.2 | 52.1% | 49.7% | (many diffs) |
3 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | XM_017002596.2 | 52% | 50.2% | (many diffs) |
4 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | XM_017002595.2 | 51.6% | 48.6% | (many diffs) |
5 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | NM_032785.4 | 51% | 48.1% | (many diffs) |
6 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | NM_001323573.2 | 50.8% | 48.6% | (many diffs) |
7 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | NM_001323574.2 | 49.8% | 47% | (many diffs) |
8 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | XM_011542308.2 | 48.5% | 46.3% | (many diffs) |
9 | human | 84871 | AGBL4 | ATP/GTP binding protein like 4 | NR_136623.2 | 26.1% | (many diffs) | |
10 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | XM_011240655.2 | 53.3% | 53.5% | (many diffs) |
11 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | NM_001048189.4 | 48.5% | 49.1% | (many diffs) |
12 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | XM_011240654.2 | 47.3% | 47.9% | (many diffs) |
13 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | NM_001284190.1 | 46.1% | 46% | (many diffs) |
14 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | XM_011240653.2 | 45.1% | 45% | (many diffs) |
15 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | XM_011240656.2 | 44.3% | 43.5% | (many diffs) |
16 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | NM_030231.3 | 42.3% | 42.5% | (many diffs) |
17 | mouse | 78933 | Agbl4 | ATP/GTP binding protein-like 4 | XM_011240652.2 | 41.4% | 41.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 873
- ORF length:
- 804
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggattacttc tttcgggagc agctgggcca gagtgtgcaa caacgaaagc 121 ttgacctcct gacgataacc agccctgaca atctccggga aggggcagag cagaaggtgg 181 tattcatcac aggacgagtc cacccagggg aaacaccctc atcatttgtg tgccaaggga 241 tcattgactt ccttgtaagc cagcacccta ttgcctgtgt cctccgggaa tacctggtct 301 tcaagatcgc accaatgctc aatcctgatg gagtctacct gggcaattac aggtgttctc 361 tgatgggatt tgatctgaat cgtcactggc tggatccctc tccatgggtc catcctaccc 421 tgcatggagt gaaacaactc atcgtccaga tgtacaacga cccaaaaaca agcctggagt 481 tttatattga catccatgcc cactccacca tgatgaatgg cttcatgtat ggcaacatct 541 ttgaggatga ggaacggttc cagaggcagg ccatttttcc caagctccTC TGCCAGAATG 601 CTGAGGACTT CTCCTATTCC AGCACATCCT TTAACCGGGA CGCTGTGAAA GCAGGAACTG 661 GCCGTCGCTT CCTCGGTGGA CTCCTGGACC ACACTTCCTA TTGCTACACC CTAGAGGTCT 721 CCTTCTACAG CTACATCATC AGTGGCACCA CGGCTGCTGT GCCCTACACT GAAGAAGCCT 781 GTATCCTTAG TCCCCACCCA GCCTTGGGCC AGCCCTCATC CAGCCGAGAG TATCCAAGTC 841 TGACAGGTCA GGAATTAGGC CCCCAGCTCA GGTTGCCAAC TTTCTTGTAC AAAGTGGTTG 901 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 961 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATA 1021 ATGTTGACCA CCACCGTGTA GTACGCGTTA AGTCgacaat caacctctgg attacaaaat 1081 ttgtgaaaga tt