Transcript: Mouse XM_011240713.1

PREDICTED: Mus musculus WD repeat domain 19 (Wdr19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr19 (213081)
Length:
6326
CDS:
98..4123

Additional Resources:

NCBI RefSeq record:
XM_011240713.1
NBCI Gene record:
Wdr19 (213081)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250033 TGGAGTTCACAGGCGATTATG pLKO_005 2451 CDS 100% 13.200 18.480 N Wdr19 n/a
2 TRCN0000250031 CCGCTTGTACATGGCGCTAAA pLKO_005 3376 CDS 100% 10.800 15.120 N Wdr19 n/a
3 TRCN0000250030 GACTTCTCACCAACCATTAAA pLKO_005 1754 CDS 100% 15.000 10.500 N Wdr19 n/a
4 TRCN0000250032 TACTGGCATCATTCACTATTT pLKO_005 1576 CDS 100% 13.200 9.240 N Wdr19 n/a
5 TRCN0000250029 ATTCTCCTTGGAGTCAGAAAC pLKO_005 6094 3UTR 100% 10.800 7.560 N Wdr19 n/a
6 TRCN0000197463 CGTTGGAACAAATAAAGGGAA pLKO.1 2223 CDS 100% 2.640 1.848 N Wdr19 n/a
7 TRCN0000198336 GCTCAGAAGATAATGTGGCAA pLKO.1 3240 CDS 100% 2.640 1.848 N Wdr19 n/a
8 TRCN0000181991 CCTCTTCAAAGTCCTGTGTGT pLKO.1 6196 3UTR 100% 2.640 1.584 N Wdr19 n/a
9 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 4494 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14236 pDONR223 100% 28.2% 26.9% None (many diffs) n/a
2 ccsbBroad304_14236 pLX_304 0% 28.2% 26.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491499 GCGGTGGAGGTTTGCACTACCTTT pLX_317 28.3% 28.2% 26.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV