Transcript: Mouse XM_011240779.2

PREDICTED: Mus musculus ras homolog family member H (Rhoh), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhoh (74734)
Length:
5634
CDS:
1323..1898

Additional Resources:

NCBI RefSeq record:
XM_011240779.2
NBCI Gene record:
Rhoh (74734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240779.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102700 GCCCAACATTCATGAATGTAT pLKO.1 1914 3UTR 100% 0.563 0.450 N Rhoh n/a
2 TRCN0000102703 GCTTCCTGCATCAATGCCATA pLKO.1 1704 CDS 100% 4.050 2.835 N Rhoh n/a
3 TRCN0000102702 GCGAAACAGAAGGAAGCTGTT pLKO.1 1850 CDS 100% 0.405 0.284 N Rhoh n/a
4 TRCN0000102704 CAACCATAACTCGTTCCTGAA pLKO.1 1580 CDS 100% 4.050 2.430 N Rhoh n/a
5 TRCN0000102701 CCAACCATAACTCGTTCCTGA pLKO.1 1579 CDS 100% 2.640 1.584 N Rhoh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240779.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00103 pDONR223 100% 90.5% 96.8% None (many diffs) n/a
2 ccsbBroad304_00103 pLX_304 0% 90.5% 96.8% V5 (many diffs) n/a
3 TRCN0000470219 ATGGTTGTCCGTTCGGTAATTCTG pLX_317 85.8% 90.5% 96.8% V5 (many diffs) n/a
Download CSV