Transcript: Mouse XM_011241262.1

PREDICTED: Mus musculus exocyst complex component 4 (Exoc4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Exoc4 (20336)
Length:
2516
CDS:
64..2286

Additional Resources:

NCBI RefSeq record:
XM_011241262.1
NBCI Gene record:
Exoc4 (20336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307390 ATCCCTACTCCACGCAAATTC pLKO_005 769 CDS 100% 13.200 18.480 N Exoc4 n/a
2 TRCN0000294720 GATTGAAGGAATCGAGCATAA pLKO_005 408 CDS 100% 10.800 15.120 N Exoc4 n/a
3 TRCN0000111725 CGAGAGTTTCTTACCGTGTAT pLKO.1 1639 CDS 100% 4.950 3.960 N Exoc4 n/a
4 TRCN0000111726 CCAGAAATATTACCGTCATAT pLKO.1 1544 CDS 100% 13.200 9.240 N Exoc4 n/a
5 TRCN0000111729 GCTGCCAAACTGGACTAACAT pLKO.1 2019 CDS 100% 5.625 3.938 N Exoc4 n/a
6 TRCN0000111727 CCAGAGTATCACAGAACGCAT pLKO.1 291 CDS 100% 2.640 1.848 N Exoc4 n/a
7 TRCN0000287212 CCAGAGTATCACAGAACGCAT pLKO_005 291 CDS 100% 2.640 1.848 N Exoc4 n/a
8 TRCN0000111728 CGCATCACTAACTCGAGGAAT pLKO.1 307 CDS 100% 0.000 0.000 N Exoc4 n/a
9 TRCN0000298307 CGCATCACTAACTCGAGGAAT pLKO_005 307 CDS 100% 0.000 0.000 N Exoc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08793 pDONR223 100% 55.9% 60.2% None (many diffs) n/a
2 ccsbBroad304_08793 pLX_304 0% 55.9% 60.2% V5 (many diffs) n/a
3 TRCN0000471162 TATGGGGGAAAAATCAGCCTTACT pLX_317 35.5% 55.9% 60.2% V5 (many diffs) n/a
Download CSV