Transcript: Mouse XM_011241264.1

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain (Sema4f), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema4f (20355)
Length:
3677
CDS:
445..2070

Additional Resources:

NCBI RefSeq record:
XM_011241264.1
NBCI Gene record:
Sema4f (20355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112274 TGGTCCCTTTAGAGAGCTAAA pLKO.1 819 CDS 100% 1.080 0.864 N Sema4f n/a
2 TRCN0000112273 CAGACAGAACTGTAGGAAGAA pLKO.1 271 5UTR 100% 4.950 3.465 N Sema4f n/a
3 TRCN0000061128 CAAGACATAGAGTCAGCAGAT pLKO.1 1405 CDS 100% 4.050 2.835 N SEMA4F n/a
4 TRCN0000291256 CAAGACATAGAGTCAGCAGAT pLKO_005 1405 CDS 100% 4.050 2.835 N SEMA4F n/a
5 TRCN0000112272 CTGTAGGAAGAAAGGCAAGAA pLKO.1 280 5UTR 100% 4.950 2.970 N Sema4f n/a
6 TRCN0000061131 CTGAGGTGACACAAGTGAATA pLKO.1 1262 CDS 100% 13.200 9.240 N SEMA4F n/a
7 TRCN0000291257 CTGAGGTGACACAAGTGAATA pLKO_005 1262 CDS 100% 13.200 9.240 N SEMA4F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11510 pDONR223 100% 71.7% 75.9% None (many diffs) n/a
2 ccsbBroad304_11510 pLX_304 0% 71.7% 75.9% V5 (many diffs) n/a
3 TRCN0000469322 TGGATATCTCGTAGCTAACCACTC pLX_317 25.7% 71.7% 75.9% V5 (many diffs) n/a
Download CSV