Transcript: Mouse XM_011241574.1

PREDICTED: Mus musculus ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 (St8sia1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St8sia1 (20449)
Length:
8270
CDS:
176..1030

Additional Resources:

NCBI RefSeq record:
XM_011241574.1
NBCI Gene record:
St8sia1 (20449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110308 CGCTTGTCTACAGGACTCTTT pLKO.1 773 CDS 100% 4.950 6.930 N St8sia1 n/a
2 TRCN0000110307 GCTCTTATACTCGTTCACCAT pLKO.1 289 CDS 100% 2.640 3.696 N St8sia1 n/a
3 TRCN0000110309 CCGTGTGTATTACACACTGAA pLKO.1 658 CDS 100% 0.495 0.396 N St8sia1 n/a
4 TRCN0000036045 CCCATCTCTTTGCTATGACTA pLKO.1 225 CDS 100% 4.950 3.465 N ST8SIA1 n/a
5 TRCN0000036046 GCCGTCAAATAGATGAAGCAA pLKO.1 417 CDS 100% 3.000 2.100 N ST8SIA1 n/a
6 TRCN0000110305 GCCTGCTTCATCTTTAACAAA pLKO.1 7356 3UTR 100% 5.625 3.375 N St8sia1 n/a
7 TRCN0000110306 CCAGCATAATTCGCCAGAGAT pLKO.1 525 CDS 100% 4.950 2.970 N St8sia1 n/a
8 TRCN0000082468 CATTTCTCTCTCTCTCTCTTT pLKO.1 7800 3UTR 100% 4.950 2.475 Y NUCKS1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5752 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01535 pDONR223 100% 69.7% 73% None (many diffs) n/a
2 ccsbBroad304_01535 pLX_304 0% 69.7% 73% V5 (many diffs) n/a
3 TRCN0000472723 GACAGCTCCACAAACTATTGCCTG pLX_317 31.8% 69.7% 73% V5 (many diffs) n/a
Download CSV