Transcript: Mouse XM_011241595.2

PREDICTED: Mus musculus phosphodiesterase 3A, cGMP inhibited (Pde3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde3a (54611)
Length:
10888
CDS:
379..2919

Additional Resources:

NCBI RefSeq record:
XM_011241595.2
NBCI Gene record:
Pde3a (54611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114984 CCAATCTTCAGGAATCCTTTA pLKO.1 2486 CDS 100% 10.800 8.640 N Pde3a n/a
2 TRCN0000114983 CCAGGTATCATACAGACTGTT pLKO.1 1629 CDS 100% 4.950 3.465 N Pde3a n/a
3 TRCN0000114981 CGCTGAAGACTCTAGCTCAAA pLKO.1 3088 3UTR 100% 4.950 3.465 N Pde3a n/a
4 TRCN0000114982 GCCAATCTTCAGGAATCCTTT pLKO.1 2485 CDS 100% 4.950 3.465 N Pde3a n/a
5 TRCN0000114985 GCTTCACAACAGTTCCCAGAA pLKO.1 1120 CDS 100% 4.050 2.835 N Pde3a n/a
6 TRCN0000048786 GCCAGAGTATAACTTCTTAAT pLKO.1 2133 CDS 100% 13.200 9.240 N PDE3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06701 pDONR223 100% 61.6% 62.9% None (many diffs) n/a
2 ccsbBroad304_06701 pLX_304 0% 61.6% 62.9% V5 (many diffs) n/a
3 TRCN0000479425 ACCAATCCGTGTGAATCCACAGTA pLX_317 7.4% 61.6% 62.9% V5 (many diffs) n/a
Download CSV