Transcript: Mouse XM_011241982.2

PREDICTED: Mus musculus potassium voltage-gated channel, subfamily Q, member 1 (Kcnq1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnq1 (16535)
Length:
2111
CDS:
118..2022

Additional Resources:

NCBI RefSeq record:
XM_011241982.2
NBCI Gene record:
Kcnq1 (16535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423705 TCAAGCTGGATAAGGATAATG pLKO_005 1442 CDS 100% 13.200 18.480 N Kcnq1 n/a
2 TRCN0000414165 ATGTTCCTCACATCACTTATG pLKO_005 1490 CDS 100% 10.800 7.560 N Kcnq1 n/a
3 TRCN0000068434 GCATTAAAGAACTACAGAGAA pLKO.1 1838 CDS 100% 4.950 3.465 N Kcnq1 n/a
4 TRCN0000068437 CCTGTCCACTATTGAGCAGTA pLKO.1 597 CDS 100% 4.050 2.835 N Kcnq1 n/a
5 TRCN0000043959 GCCAAGAAGAAATTCCAGCAA pLKO.1 1747 CDS 100% 2.640 1.848 N KCNQ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00903 pDONR223 100% 60.8% 60.8% None (many diffs) n/a
2 ccsbBroad304_00903 pLX_304 0% 60.8% 60.8% V5 (many diffs) n/a
3 TRCN0000479670 CAAGAGGGCTGTCGGTTGTTCTCG pLX_317 18.9% 60.8% 60.8% V5 (many diffs) n/a
Download CSV