Transcript: Mouse XM_011242396.2

PREDICTED: Mus musculus ubiquitination factor E4A (Ube4a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube4a (140630)
Length:
6028
CDS:
250..3450

Additional Resources:

NCBI RefSeq record:
XM_011242396.2
NBCI Gene record:
Ube4a (140630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092079 GCCCGAAATCTTCTTCCAAAT pLKO.1 1512 CDS 100% 10.800 15.120 N Ube4a n/a
2 TRCN0000092082 CCTGAATATCTCGTGCTTGTT pLKO.1 1248 CDS 100% 4.950 6.930 N Ube4a n/a
3 TRCN0000092081 CGTCCTATGTATCCCATCCTA pLKO.1 2485 CDS 100% 3.000 4.200 N Ube4a n/a
4 TRCN0000092080 GCTCGATTATTGCTTCAAGAT pLKO.1 667 CDS 100% 4.950 3.465 N Ube4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11359 pDONR223 100% 92.2% 97.3% None (many diffs) n/a
2 ccsbBroad304_11359 pLX_304 0% 92.2% 97.3% V5 (many diffs) n/a
3 TRCN0000479406 GGCAGAATCTGCAACGCAGCTGTA pLX_317 9.5% 92.2% 97.3% V5 (many diffs) n/a
Download CSV