Transcript: Mouse XM_011242433.1

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (St3gal4), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal4 (20443)
Length:
2063
CDS:
205..1206

Additional Resources:

NCBI RefSeq record:
XM_011242433.1
NBCI Gene record:
St3gal4 (20443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018831 GCCATCACTAGCTATTCTATA pLKO.1 508 CDS 100% 13.200 9.240 N St3gal4 n/a
2 TRCN0000278754 GCCATCACTAGCTATTCTATA pLKO_005 508 CDS 100% 13.200 9.240 N St3gal4 n/a
3 TRCN0000018829 CGACGTGGTCATCAGATTGAA pLKO.1 627 CDS 100% 5.625 3.938 N St3gal4 n/a
4 TRCN0000278805 CGACGTGGTCATCAGATTGAA pLKO_005 627 CDS 100% 5.625 3.938 N St3gal4 n/a
5 TRCN0000018828 GATAGGTACATTGAGTTCTTT pLKO.1 289 CDS 100% 5.625 3.938 N St3gal4 n/a
6 TRCN0000278859 GATAGGTACATTGAGTTCTTT pLKO_005 289 CDS 100% 5.625 3.938 N St3gal4 n/a
7 TRCN0000018830 CATCCACTACTATGAACAGAT pLKO.1 1080 CDS 100% 4.950 3.465 N St3gal4 n/a
8 TRCN0000278802 CATCCACTACTATGAACAGAT pLKO_005 1080 CDS 100% 4.950 3.465 N St3gal4 n/a
9 TRCN0000018827 CCACTGGATTGAGACCATCTT pLKO.1 795 CDS 100% 4.950 3.465 N St3gal4 n/a
10 TRCN0000278752 CCACTGGATTGAGACCATCTT pLKO_005 795 CDS 100% 4.950 3.465 N St3gal4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11132 pDONR223 100% 86.4% 89.4% None (many diffs) n/a
2 ccsbBroad304_11132 pLX_304 0% 86.4% 89.4% V5 (many diffs) n/a
3 TRCN0000468712 TGGTCCGGTGATTACACGGAGTCC pLX_317 34.5% 86.4% 89.4% V5 (many diffs) n/a
Download CSV