Transcript: Mouse XM_011242946.2

PREDICTED: Mus musculus endo/exonuclease (5'-3'), endonuclease G-like (Exog), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Exog (208194)
Length:
3967
CDS:
607..1293

Additional Resources:

NCBI RefSeq record:
XM_011242946.2
NBCI Gene record:
Exog (208194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191029 CGGAGAGATTTGAAGATGTTT pLKO.1 743 CDS 100% 5.625 7.875 N Exog n/a
2 TRCN0000201610 CCTGTCTTACGATCAGGCAAA pLKO.1 429 5UTR 100% 4.050 5.670 N Exog n/a
3 TRCN0000201784 GCATTGTGTTTGCCTCCGATA pLKO.1 2154 3UTR 100% 4.050 3.240 N Exog n/a
4 TRCN0000190456 GCACCTTTACAAGGTGATCCT pLKO.1 864 CDS 100% 0.264 0.185 N Exog n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11435 pDONR223 100% 83.5% 85% None (many diffs) n/a
2 ccsbBroad304_11435 pLX_304 0% 83.5% 85% V5 (many diffs) n/a
3 TRCN0000468541 GTACTCTCGCCCATACTTCCATAC pLX_317 60.1% 83.5% 85% V5 (many diffs) n/a
Download CSV