Transcript: Mouse XM_011243109.1

PREDICTED: Mus musculus PR domain containing 1, with ZNF domain (Prdm1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prdm1 (12142)
Length:
5361
CDS:
499..2868

Additional Resources:

NCBI RefSeq record:
XM_011243109.1
NBCI Gene record:
Prdm1 (12142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235770 ACTATTGCCTAGCCATAATTA pLKO_005 3201 3UTR 100% 15.000 21.000 N Prdm1 n/a
2 TRCN0000084714 CCCTGCCAAGTTTACGCAATT pLKO.1 2382 CDS 100% 10.800 15.120 N Prdm1 n/a
3 TRCN0000084717 CCGTCTACAGTAACCTCCTTA pLKO.1 1727 CDS 100% 4.950 6.930 N Prdm1 n/a
4 TRCN0000084715 CGTGGTAAGTAAGGAGTACAT pLKO.1 693 CDS 100% 4.950 6.930 N Prdm1 n/a
5 TRCN0000235769 TGTTGCCACCGTACGGCATTA pLKO_005 1634 CDS 100% 10.800 8.640 N Prdm1 n/a
6 TRCN0000013609 CGGGATGAACATCTACTTCTA pLKO.1 927 CDS 100% 4.950 3.960 N PRDM1 n/a
7 TRCN0000235771 CATCTACTTCTACACTATTAA pLKO_005 936 CDS 100% 15.000 10.500 N Prdm1 n/a
8 TRCN0000084716 CGGAGCCATGAATCTCATTAA pLKO.1 2022 CDS 100% 13.200 9.240 N Prdm1 n/a
9 TRCN0000084713 GCAACCTTTCTCTATGATAAT pLKO.1 3424 3UTR 100% 13.200 9.240 N Prdm1 n/a
10 TRCN0000235772 GGACATGGAGGACGCTGATAT pLKO_005 507 CDS 100% 13.200 9.240 N Prdm1 n/a
11 TRCN0000235768 GGTTCGACATCAGCGACAATG pLKO_005 2585 CDS 100% 10.800 7.560 N Prdm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00163 pDONR223 100% 75.8% 77.3% None (many diffs) n/a
2 ccsbBroad304_00163 pLX_304 32.4% 75.8% 77.3% V5 (many diffs) n/a
3 TRCN0000492300 CGTCGGGTCCTCGACTCTACATTA pLX_317 10.7% 75.8% 77.3% V5 (many diffs) n/a
Download CSV