Transcript: Mouse XM_011243212.2

PREDICTED: Mus musculus tRNA methyltransferase 11 (Trmt11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trmt11 (73681)
Length:
1940
CDS:
361..1539

Additional Resources:

NCBI RefSeq record:
XM_011243212.2
NBCI Gene record:
Trmt11 (73681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279493 TCTATTGGCTACCAGTATATA pLKO_005 1259 CDS 100% 15.000 12.000 N Trmt11 n/a
2 TRCN0000193588 GACATACCAAAGGGAATAGAA pLKO.1 1129 CDS 100% 5.625 4.500 N Trmt11 n/a
3 TRCN0000279422 GACATACCAAAGGGAATAGAA pLKO_005 1129 CDS 100% 5.625 4.500 N Trmt11 n/a
4 TRCN0000176129 GCACTTGAATTTCTGCCGTTT pLKO.1 544 CDS 100% 4.050 3.240 N Trmt11 n/a
5 TRCN0000279490 GCACTTGAATTTCTGCCGTTT pLKO_005 544 CDS 100% 4.050 3.240 N Trmt11 n/a
6 TRCN0000279492 GCATTCAGATTCGACATATAA pLKO_005 462 CDS 100% 15.000 10.500 N Trmt11 n/a
7 TRCN0000175758 GCCACATACATGGTAGGTAAT pLKO.1 1811 3UTR 100% 10.800 7.560 N Trmt11 n/a
8 TRCN0000193922 CCTTATAGCATCTGCTCACTT pLKO.1 843 CDS 100% 4.950 3.465 N Trmt11 n/a
9 TRCN0000279491 AGTGTCAGGGACTGGTATATA pLKO_005 1738 3UTR 100% 15.000 9.000 N Trmt11 n/a
10 TRCN0000158425 CCTGTTTCCTTGAGTTATCAT pLKO.1 1171 CDS 100% 5.625 3.938 N TRMT11 n/a
11 TRCN0000276165 CCTGTTTCCTTGAGTTATCAT pLKO_005 1171 CDS 100% 5.625 3.938 N TRMT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08794 pDONR223 100% 76.4% 77.7% None (many diffs) n/a
2 ccsbBroad304_08794 pLX_304 0% 76.4% 77.7% V5 (many diffs) n/a
3 TRCN0000478001 ACTTGACGTTACCGTTCGACTTCC pLX_317 20.3% 76.4% 77.7% V5 (many diffs) n/a
Download CSV