Transcript: Mouse XM_011243256.2

PREDICTED: Mus musculus septin 10 (Sept10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sept10 (103080)
Length:
1735
CDS:
346..1716

Additional Resources:

NCBI RefSeq record:
XM_011243256.2
NBCI Gene record:
Sept10 (103080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243256.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347507 ACACGACCTCCAAGATCAATG pLKO_005 1007 CDS 100% 10.800 7.560 N Sept10 n/a
2 TRCN0000175279 CAAGGCAGATACAATTTCTAA pLKO.1 900 CDS 100% 5.625 3.938 N Sept10 n/a
3 TRCN0000347505 CAAGGCAGATACAATTTCTAA pLKO_005 900 CDS 100% 5.625 3.938 N Sept10 n/a
4 TRCN0000194623 GCAGACACATATGAGGCACTA pLKO.1 1212 CDS 100% 0.000 0.000 N Sept10 n/a
5 TRCN0000347587 GCAGACACATATGAGGCACTA pLKO_005 1212 CDS 100% 0.000 0.000 N Sept10 n/a
6 TRCN0000176403 CTCCAAGATCAATGGAGCAAT pLKO.1 1014 CDS 100% 0.495 0.297 N Sept10 n/a
7 TRCN0000139056 CAGGCCAAATTTGAGCACCTT pLKO.1 1441 CDS 100% 2.640 1.848 N SEPTIN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243256.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05045 pDONR223 100% 77.5% 75.4% None (many diffs) n/a
2 ccsbBroad304_05045 pLX_304 0% 77.5% 75.4% V5 (many diffs) n/a
3 TRCN0000470390 ACGAGCTTACTATCCAGCAACTCG pLX_317 33.5% 77.5% 75.4% V5 (many diffs) n/a
Download CSV