Construct: ORF TRCN0000470390
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010139.1_s317c1
- Derived from:
- ccsbBroadEn_05045
- DNA Barcode:
- ACGAGCTTACTATCCAGCAACTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SEPTIN10 (151011)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470390
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 151011 | SEPTIN10 | septin 10 | NM_144710.5 | 100% | 100% | |
2 | human | 151011 | SEPTIN10 | septin 10 | NM_001321512.2 | 99% | 98.8% | 1350_1350delGinsCTCCAATTTTTTG |
3 | human | 151011 | SEPTIN10 | septin 10 | NM_001321513.2 | 96.9% | 96.6% | 1_1delAins28;1323_1323delGinsCTCCAATTTTTTG |
4 | human | 151011 | SEPTIN10 | septin 10 | NM_001321514.2 | 96.6% | 96.6% | 0_1ins45 |
5 | human | 151011 | SEPTIN10 | septin 10 | NM_178584.4 | 94.9% | 94.9% | 30_31ins69 |
6 | human | 151011 | SEPTIN10 | septin 10 | NM_001321500.2 | 93.9% | 93.8% | 30_31ins69;1281_1281delGinsCTCCAATTTTTTG |
7 | human | 151011 | SEPTIN10 | septin 10 | XM_006712317.2 | 92.8% | 92% | (many diffs) |
8 | human | 151011 | SEPTIN10 | septin 10 | NM_001321515.2 | 92.8% | 92.7% | 0_1ins96;3G>A |
9 | human | 151011 | SEPTIN10 | septin 10 | NM_001321509.2 | 90.7% | 90.7% | 0_1ins126 |
10 | human | 151011 | SEPTIN10 | septin 10 | NM_001321501.2 | 89.7% | 89.6% | 0_1ins126;1224_1224delGinsCTCCAATTTTTTG |
11 | human | 151011 | SEPTIN10 | septin 10 | NM_001321498.2 | 83.4% | 82.5% | 1350_1432del;1446_1632del |
12 | human | 151011 | SEPTIN10 | septin 10 | XM_011510703.2 | 81.7% | 80.6% | 1_1delAins28;1323_1405del;1419_1605del |
13 | human | 151011 | SEPTIN10 | septin 10 | XM_011510698.2 | 80.6% | 79.7% | 0_1ins45;1305_1387del;1401_1587del |
14 | human | 151011 | SEPTIN10 | septin 10 | XM_011510699.2 | 79.2% | 78.3% | 30_31ins69;1281_1363del;1377_1563del |
15 | human | 151011 | SEPTIN10 | septin 10 | XM_011510704.3 | 79% | 76.2% | 1026_1027ins133;1077_1078ins152 |
16 | human | 151011 | SEPTIN10 | septin 10 | XM_011510700.2 | 75.7% | 74.8% | 0_1ins126;1224_1306del;1320_1506del |
17 | human | 151011 | SEPTIN10 | septin 10 | NM_001321502.2 | 74% | 71.1% | 30_31ins69;957_958ins133;1008_1009ins152 |
18 | human | 151011 | SEPTIN10 | septin 10 | NM_001321496.2 | 70.2% | 69.8% | (many diffs) |
19 | human | 151011 | SEPTIN10 | septin 10 | NM_001321507.2 | 69.3% | 68.7% | (many diffs) |
20 | human | 151011 | SEPTIN10 | septin 10 | NM_001321510.2 | 63.2% | 63.2% | 99_100ins501 |
21 | human | 151011 | SEPTIN10 | septin 10 | NM_001321499.2 | 62.2% | 62.1% | 99_100ins501;849_849delGinsCTCCAATTTTTTG |
22 | human | 151011 | SEPTIN10 | septin 10 | XM_011510701.3 | 58.6% | 57.3% | (many diffs) |
23 | human | 151011 | SEPTIN10 | septin 10 | NM_001321505.2 | 57.4% | 57.4% | 0_1ins579 |
24 | human | 151011 | SEPTIN10 | septin 10 | NM_001321506.2 | 57.4% | 55.9% | (many diffs) |
25 | human | 151011 | SEPTIN10 | septin 10 | NM_001321504.2 | 56.5% | 56.3% | 0_1ins579;771_771delGinsCTCCAATTTTTTG |
26 | human | 151011 | SEPTIN10 | septin 10 | NM_001321511.2 | 56.5% | 54.8% | (many diffs) |
27 | human | 151011 | SEPTIN10 | septin 10 | XM_011510702.2 | 52.7% | 51.8% | 99_100ins501;849_931del;945_1131del |
28 | human | 151011 | SEPTIN10 | septin 10 | XR_922870.3 | 37.7% | 1_378del;1404_1405ins133;1608_3120del | |
29 | human | 151011 | SEPTIN10 | septin 10 | NM_001321508.2 | 36.5% | 33.7% | 0_1ins579;447_448ins133;498_499ins152 |
30 | human | 151011 | SEPTIN10 | septin 10 | NM_001321503.2 | 36.5% | 32.1% | (many diffs) |
31 | mouse | 103080 | Sept10 | septin 10 | XM_011243255.2 | 81.9% | 80.4% | (many diffs) |
32 | mouse | 103080 | Sept10 | septin 10 | NM_001024911.2 | 81% | 81% | (many diffs) |
33 | mouse | 103080 | Sept10 | septin 10 | XM_011243256.2 | 77.5% | 75.4% | (many diffs) |
34 | mouse | 103080 | Sept10 | septin 10 | NM_001024910.3 | 76.7% | 75.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1428
- ORF length:
- 1362
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctcctccgag gtggcgcggc acctgctctt tcagtctcac atggcaacga 121 aaacaacttg tatgtcttca caaggatcag atgatgaaca gataaaaaga gaaaacattc 181 gttcgttgac tatgtctggc catgttggtt ttgagagttt gcctgatcag ctggtgaaca 241 gatccattca gcaaggtttc tgctttaata ttctctgtgt gggggaaact ggaattggaa 301 aatcaacact gattgacaca ttgtttaata ctaattttga agactatgaa tcctcacatt 361 tttgcccaaa tgttaaactt aaagctcaga catatgaact ccaggaaagt aatgttcaat 421 tgaaattgac cattgtgaat acagtgggat ttggtgacca aataaataaa gaagagagct 481 accaaccaat agttgactac atagatgctc agtttgaggc ctatctccaa gaagaactga 541 agattaagcg ttctctcttt acctaccatg attctcgcat ccatgtgtgt ctctacttca 601 tttcaccgac aggccactct ctgaagacac ttgatctctt aaccatgaag aaccttgaca 661 gcaaggtaaa cattatacca gtgattgcca aagcagatac ggtttctaaa actgaattac 721 agaagtttaa gatcaagctc atgagtgaat tggtcagcaa tggcgtccag atataccagt 781 tcccaacgga tgatgacact attgctaagg tcaacgctgc aatgaatgga cagttgccgt 841 ttgctgttgt gggaagtatg gatgaggtaa aagtcggaaa caagatggtc aaagctcgcc 901 agtacccttg gggtgttgta caagtggaaa atgaaaacca ctgtgacttt gtaaagctgc 961 gggaaatgct catttGTACA AATATGGAGG ACCTGCGAGA GCAGACCCAT ACCAGGCACT 1021 ATGAGCTTTA CAGGCGCTGC AAACTGGAGG AAATGGGCTT TACAGATGTG GGCCCAGAAA 1081 ACAAGCCAGT CAGTGTTCAA GAGACCTATG AAGCCAAAAG ACATGAGTTC CATGGTGAAC 1141 GTCAGAGGAA GGAAGAAGAA ATGAAACAGA TGTTTGTGCA GCGAGTAAAG GAGAAAGAAG 1201 CCATATTGAA AGAAGCTGAG AGAGAGCTAC AGGCCAAATT TGAGCACCTT AAGAGACTTC 1261 ACCAAGAAGA GAGAATGAAG CTTGAAGAAA AGAGAAGACT TTTGGAAGAA GAAATAATTG 1321 CTTTCTCTAA AAAGAAAGCT ACCTCCGAGA TATTTCACAG CCAGTCCTTT CTGGCAACAG 1381 GCAGCAACCT GAGGAAGGAC AAGGACCGTA AGAACTCCAA TTTTTTGTAC CCAACTTTCT 1441 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1501 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1561 GTGGAAAGGA CGAACGAGCT TACTATCCAG CAACTCGACG CGTTAAGTCg acaatcaacc 1621 tctggattac aaaatttgtg aaagatt