Transcript: Mouse XM_011243461.2

PREDICTED: Mus musculus synapsin III (Syn3), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syn3 (27204)
Length:
1315
CDS:
371..1189

Additional Resources:

NCBI RefSeq record:
XM_011243461.2
NBCI Gene record:
Syn3 (27204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093505 CCATACAGACTGGTCAAAGTA pLKO.1 670 CDS 100% 5.625 3.938 N Syn3 n/a
2 TRCN0000093506 GTTGTGAGAAATGGCACCAAA pLKO.1 803 CDS 100% 4.950 3.465 N Syn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01873 pDONR223 100% 40.6% 41.6% None (many diffs) n/a
2 ccsbBroad304_01873 pLX_304 0% 40.6% 41.6% V5 (many diffs) n/a
3 TRCN0000475371 GCTAAGTTTATGTTCCCTATCCCT pLX_317 19.6% 40.6% 41.6% V5 (many diffs) n/a
Download CSV