Transcript: Mouse XM_011243603.3

PREDICTED: Mus musculus NUAK family, SNF1-like kinase, 1 (Nuak1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Nuak1 (77976)
Length:
5207
CDS:
281..1861

Additional Resources:

NCBI RefSeq record:
XM_011243603.3
NBCI Gene record:
Nuak1 (77976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360830 CCGGAGGAAGGGCATCTTAAA pLKO_005 1444 CDS 100% 13.200 18.480 N Nuak1 n/a
2 TRCN0000221206 CCGTCCAGTATCATCAGTGAT pLKO.1 1589 CDS 100% 4.950 6.930 N Nuak1 n/a
3 TRCN0000360831 ACGATGTGACTCAGGTGTATA pLKO_005 1806 CDS 100% 13.200 9.240 N Nuak1 n/a
4 TRCN0000321667 TTGATGACAACTGCAACATTA pLKO_005 444 CDS 100% 13.200 9.240 N Nuak1 n/a
5 TRCN0000321666 GATTGTGTCTGCCGTGCATTA pLKO_005 370 CDS 100% 10.800 7.560 N Nuak1 n/a
6 TRCN0000221209 GCTTGATGACAACTGCAACAT pLKO.1 442 CDS 100% 4.950 3.465 N Nuak1 n/a
7 TRCN0000221208 GCAGAGAGAATCTGGCTACTA pLKO.1 1303 CDS 100% 4.950 2.970 N Nuak1 n/a
8 TRCN0000321730 GCAGAGAGAATCTGGCTACTA pLKO_005 1303 CDS 100% 4.950 2.970 N Nuak1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491441 AATCGGACAGTCCTAAGGGAAGTC pLX_317 18.2% 68.7% 72.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV