Transcript: Mouse XM_011243716.1

PREDICTED: Mus musculus IKAROS family zinc finger 1 (Ikzf1), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ikzf1 (22778)
Length:
3827
CDS:
40..1296

Additional Resources:

NCBI RefSeq record:
XM_011243716.1
NBCI Gene record:
Ikzf1 (22778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430029 AGCTCTTTAGAGGAGCATAAA pLKO_005 418 CDS 100% 13.200 18.480 N Ikzf1 n/a
2 TRCN0000085516 CCGTTGGTAAGCCTCACAAAT pLKO.1 365 CDS 100% 13.200 18.480 N Ikzf1 n/a
3 TRCN0000420145 TTGCCCTAAGCAGAGTTTATG pLKO_005 1652 3UTR 100% 13.200 18.480 N Ikzf1 n/a
4 TRCN0000085514 CGGCCTTATCTACCTAACCAA pLKO.1 963 CDS 100% 3.000 4.200 N Ikzf1 n/a
5 TRCN0000085517 GCCCTATGACAGTGCCAACTA pLKO.1 618 CDS 100% 4.950 3.960 N Ikzf1 n/a
6 TRCN0000413292 GAGCCAGAGGACCAGATATAA pLKO_005 1746 3UTR 100% 15.000 10.500 N Ikzf1 n/a
7 TRCN0000415420 TATTGTGGCCGGAGCTATAAA pLKO_005 391 CDS 100% 15.000 10.500 N Ikzf1 n/a
8 TRCN0000085513 AGCACAAAGATAGCTGGTTAT pLKO.1 1317 3UTR 100% 10.800 7.560 N Ikzf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11482 pDONR223 100% 63.1% 66.6% None (many diffs) n/a
2 ccsbBroad304_11482 pLX_304 0% 63.1% 66.6% V5 (many diffs) n/a
3 TRCN0000479864 CTGCACAGGTGAAGTGAGACAATT pLX_317 16.8% 63.1% 66.6% V5 (many diffs) n/a
Download CSV