Transcript: Mouse XM_011243775.2

PREDICTED: Mus musculus microrchidia 2A (Morc2a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Morc2a (74522)
Length:
5593
CDS:
1124..4219

Additional Resources:

NCBI RefSeq record:
XM_011243775.2
NBCI Gene record:
Morc2a (74522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248627 TCGAAATTGCTTGCGGTATTT pLKO_005 3865 CDS 100% 13.200 18.480 N Morc2a n/a
2 TRCN0000178836 CCTCAACATAGGATGAAGAAA pLKO.1 4489 3UTR 100% 5.625 7.875 N Morc2a n/a
3 TRCN0000248628 GAGAGCCGGAACTAGACATAA pLKO_005 1752 CDS 100% 13.200 10.560 N Morc2a n/a
4 TRCN0000248629 CCCAATATGCCACCTACTTTG pLKO_005 4767 3UTR 100% 10.800 8.640 N Morc2a n/a
5 TRCN0000248631 GACTCTCCTGCTGCCTATATA pLKO_005 1920 CDS 100% 15.000 10.500 N Morc2a n/a
6 TRCN0000248630 TATGCTGCTGTACTCTATATT pLKO_005 1850 CDS 100% 15.000 10.500 N Morc2a n/a
7 TRCN0000184505 GCTCCGAAAGACGTCTGTTAT pLKO.1 3040 CDS 100% 13.200 9.240 N Morc2a n/a
8 TRCN0000195782 CCAGACAGCTTGGAGATGTTT pLKO.1 4730 3UTR 100% 5.625 3.938 N Morc2a n/a
9 TRCN0000155342 GTTTGCTCCATGAACCCTGAT pLKO.1 2693 CDS 100% 4.050 2.430 N MORC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07811 pDONR223 100% 81.3% 84.8% None (many diffs) n/a
2 ccsbBroad304_07811 pLX_304 0% 81.3% 84.8% V5 (many diffs) n/a
3 TRCN0000468141 GCTCTCAGGCGCCCAGATGCCCTC pLX_317 3.3% 81.3% 84.8% V5 (many diffs) n/a
Download CSV