Transcript: Mouse XM_011244107.2

PREDICTED: Mus musculus vasohibin 1 (Vash1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vash1 (238328)
Length:
5271
CDS:
853..1491

Additional Resources:

NCBI RefSeq record:
XM_011244107.2
NBCI Gene record:
Vash1 (238328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194532 GATTGAATGGAAGCACTCGGT pLKO.1 1209 CDS 100% 0.660 0.528 N Vash1 n/a
2 TRCN0000193089 CAGGGACACAATTCTTTGAAA pLKO.1 803 5UTR 100% 5.625 3.938 N Vash1 n/a
3 TRCN0000173412 GCTTTCCCATCAGCTTCAAGA pLKO.1 956 CDS 100% 4.950 3.465 N Vash1 n/a
4 TRCN0000193630 CAAGACCTATTTCTCAGGGAA pLKO.1 972 CDS 100% 2.640 1.848 N Vash1 n/a
5 TRCN0000139046 CCTGGGAATTTACCTCACCAA pLKO.1 915 CDS 100% 2.640 1.848 N VASH1 n/a
6 TRCN0000139620 CTGCCAATCAAATGCCTGGAA pLKO.1 886 CDS 100% 2.640 1.848 N VASH1 n/a
7 TRCN0000144795 GAAATTAAGAAGAGCAGACCT pLKO.1 820 5UTR 100% 2.640 1.848 N VASH1 n/a
8 TRCN0000140443 GAGCTGCAGTACAATCACACA pLKO.1 784 5UTR 100% 2.640 1.848 N VASH1 n/a
9 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 3390 3UTR 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02692 pDONR223 100% 52.6% 55.8% None (many diffs) n/a
2 ccsbBroad304_02692 pLX_304 0% 52.6% 55.8% V5 (many diffs) n/a
3 TRCN0000466840 GGAAAGCAACCCCCCTCCGTTCAG pLX_317 33% 52.6% 55.8% V5 (many diffs) n/a
Download CSV