Construct: ORF TRCN0000466840
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015893.1_s317c1
- Derived from:
- ccsbBroadEn_02692
- DNA Barcode:
- GGAAAGCAACCCCCCTCCGTTCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VASH1 (22846)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466840
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 22846 | VASH1 | vasohibin 1 | NM_014909.5 | 100% | 100% | |
| 2 | human | 22846 | VASH1 | vasohibin 1 | XM_017021087.1 | 58% | 58% | 0_1ins459 |
| 3 | human | 22846 | VASH1 | vasohibin 1 | XM_017021088.1 | 58% | 58% | 0_1ins459 |
| 4 | human | 22846 | VASH1 | vasohibin 1 | XM_017021089.1 | 58% | 58% | 0_1ins459 |
| 5 | human | 22846 | VASH1 | vasohibin 1 | XM_017021090.1 | 58% | 58% | 0_1ins459 |
| 6 | human | 22846 | VASH1 | vasohibin 1 | XM_017021091.1 | 50.1% | 50.1% | 0_1ins546 |
| 7 | human | 22846 | VASH1 | vasohibin 1 | XR_001750190.1 | 13.7% | 1_1365del;1895_3398del;3965_7966del | |
| 8 | mouse | 238328 | Vash1 | vasohibin 1 | NM_177354.4 | 86.6% | 91.2% | (many diffs) |
| 9 | mouse | 238328 | Vash1 | vasohibin 1 | XM_011244107.2 | 52.6% | 55.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc aggggggaag aaggtggctg ggggtggcag cagcggtgcc actccaacgt 121 ccgctgcggc caccgccccc tctggggtca ggcgtttgga gaccagcgaa ggaacctcag 181 cccagagaga tgaggagcca gaagaggaag gggaagagga cctgcgagac ggaggcgtcc 241 ccttctttgt caaccggggt gggctacctg tggatgaggc cacctgggaa aggatgtgga 301 aacacgtggc caagatccac cccgatggag agaaggtggc gcaacggatc cgtggggcca 361 cagacctgcc caagatcccc ataccgagtg tgcctacgtt ccagccgtct acacctgtcc 421 ctgagcgcct ggaagctgtg cagcgctaca tcagagagct gcagtacaat cacacaggga 481 cacagttctt tgaaattaag aagagcagac ctctgacagg gctgatggac ctggccaagg 541 aaatgaccaa agaggccctg ccaatcaaat gcctggaagc cgtgatcctg ggaatttacc 601 tcaccaacag catgcccacc ctggagcgct tccccatcag cttcaagacc tacttctcag 661 ggaactactt ccgccacatc gtgctggggg tgaacttcgc gggccgctac ggtgcgctgg 721 gcatgagtcg gcgcgaggac ctgatgtaca agccgcccgc cttccgcacg ctcagcgagc 781 tcgtgctgga cttcgaggcc gccTACGGCC GCTGCTGGCA CGTGCTCAAG AAGGTGAAGC 841 TGGGCCAGAG CGTGTCACAC GACCCGCACA GCGTGGAGCA GATCGAGTGG AAGCACTCGG 901 TGCTGGACGT GGAGCGCCTG GGCCGCGATG ACTTCCGCAA GGAGCTGGAG CGCCACGCCC 961 GCGACATGCG GCTCAAGATT GGCAAAGGGA CGGGCCCTCC CTCTCCCACC AAGGACCGGA 1021 AGAAGGATGT TTCTTCCCCG CAGCGGGCCC AGTCCAGCCC CCACCGCAGG AACAGCCGCA 1081 GTGAAAGACG GCCCTCGGGT GACAAGAAGA CTTCCGAGCC CAAAGCCATG CCAGACCTTA 1141 ACGGGTACCA GATCCGGGTC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGAA AGCAACCCCC 1321 CTCCGTTCAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt