Transcript: Mouse XM_011244169.1

PREDICTED: Mus musculus angel homolog 1 (Drosophila) (Angel1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Angel1 (68737)
Length:
3856
CDS:
5..2077

Additional Resources:

NCBI RefSeq record:
XM_011244169.1
NBCI Gene record:
Angel1 (68737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095512 CCAATGGAAATACCTTATCAT pLKO.1 692 CDS 100% 5.625 7.875 N Angel1 n/a
2 TRCN0000095513 CCGAGACTTCCTACTACGATT pLKO.1 1588 CDS 100% 4.950 6.930 N Angel1 n/a
3 TRCN0000095509 GCGGGAGTTATTGATCTCATT pLKO.1 2347 3UTR 100% 4.950 6.930 N Angel1 n/a
4 TRCN0000418123 TATTCGCTTTCAGGCCATTTC pLKO_005 2371 3UTR 100% 10.800 7.560 N Angel1 n/a
5 TRCN0000422401 TGGCGAGAATGGGAGGATTTC pLKO_005 722 CDS 100% 10.800 7.560 N Angel1 n/a
6 TRCN0000095511 CCTGTGAGAATGAGAACAGAA pLKO.1 1893 CDS 100% 4.950 3.465 N Angel1 n/a
7 TRCN0000095510 GCCGAGTGTATCTTTGAGGAA pLKO.1 1700 CDS 100% 2.640 1.848 N Angel1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07870 pDONR223 100% 85.7% 83.8% None (many diffs) n/a
2 ccsbBroad304_07870 pLX_304 0% 85.7% 83.8% V5 (many diffs) n/a
3 TRCN0000479304 ATACAAATCGATTCTACTCCTATA pLX_317 19.5% 85.7% 83.8% V5 (many diffs) n/a
Download CSV