Transcript: Mouse XM_011244226.2

PREDICTED: Mus musculus exonuclease 3'-5' domain containing 2 (Exd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Exd2 (97827)
Length:
2895
CDS:
275..1765

Additional Resources:

NCBI RefSeq record:
XM_011244226.2
NBCI Gene record:
Exd2 (97827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216762 GTAATGGGCTTAGCCTGAAAT pLKO.1 504 CDS 100% 13.200 10.560 N Exd2 n/a
2 TRCN0000191054 CCCAGGAGATTATTACTTGAT pLKO.1 1120 CDS 100% 4.950 3.960 N Exd2 n/a
3 TRCN0000241906 CGCTTGCCCAGGCTGATATAT pLKO_005 308 CDS 100% 15.000 10.500 N Exd2 n/a
4 TRCN0000241905 ACAAGCTTCTACAGGATTATG pLKO_005 417 CDS 100% 13.200 9.240 N Exd2 n/a
5 TRCN0000241903 CCCAGTTCAGCCTCACTATTT pLKO_005 2188 3UTR 100% 13.200 9.240 N Exd2 n/a
6 TRCN0000241902 CGGCTGGTTGAAGAGGTTAAT pLKO_005 794 CDS 100% 13.200 9.240 N Exd2 n/a
7 TRCN0000217417 GGCAGATGGTGCTATCTTAAA pLKO.1 367 CDS 100% 13.200 9.240 N Exd2 n/a
8 TRCN0000241904 TGGCAGATGGTGCTATCTTAA pLKO_005 366 CDS 100% 13.200 9.240 N Exd2 n/a
9 TRCN0000191421 CCAACTGTATTACTTGGATTT pLKO.1 2252 3UTR 100% 10.800 7.560 N Exd2 n/a
10 TRCN0000190454 GCAGATTTCAGTGGCTCTCTT pLKO.1 640 CDS 100% 4.950 3.465 N Exd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03552 pDONR223 100% 86.4% 87.5% None (many diffs) n/a
2 ccsbBroad304_03552 pLX_304 0% 86.4% 87.5% V5 (many diffs) n/a
3 TRCN0000473850 AGGAGTAGTTAGACATCTGCCGGA pLX_317 38.6% 86.4% 87.5% V5 (many diffs) n/a
Download CSV