Transcript: Mouse XM_011244266.2

PREDICTED: Mus musculus cytidine monophospho-N-acetylneuraminic acid hydroxylase (Cmah), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cmah (12763)
Length:
4446
CDS:
1451..3193

Additional Resources:

NCBI RefSeq record:
XM_011244266.2
NBCI Gene record:
Cmah (12763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098761 CGTGGAGTACAAAGGTCATAA pLKO.1 2281 CDS 100% 13.200 18.480 N Cmah n/a
2 TRCN0000098762 GTGGAGTACAAAGGTCATAAA pLKO.1 2282 CDS 100% 13.200 18.480 N Cmah n/a
3 TRCN0000451993 GTCCGTTTGCTGGGTACTTTG pLKO_005 2526 CDS 100% 10.800 15.120 N Cmah n/a
4 TRCN0000448975 ACAGCCATAACTACCATTATT pLKO_005 3289 3UTR 100% 15.000 12.000 N Cmah n/a
5 TRCN0000098764 CGTTAAATGCACAAAGCACAA pLKO.1 1675 CDS 100% 4.050 3.240 N Cmah n/a
6 TRCN0000447616 CACACCTGTATAACCCTAAAT pLKO_005 3611 3UTR 100% 13.200 9.240 N Cmah n/a
7 TRCN0000098760 CCCAGTTCATTAAGGCTGAAA pLKO.1 2445 CDS 100% 4.950 3.465 N Cmah n/a
8 TRCN0000098763 CCTCATTTATATCAGCCACAT pLKO.1 2026 CDS 100% 4.050 2.835 N Cmah n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3573 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10228 pDONR223 100% 37.2% 35.4% None (many diffs) n/a
2 ccsbBroad304_10228 pLX_304 0% 37.2% 35.4% V5 (many diffs) n/a
3 TRCN0000477513 TGCCCGTGGCAAGAAAGTAGCAAA pLX_317 49.6% 37.2% 35.4% V5 (many diffs) n/a
Download CSV