Transcript: Mouse XM_011244326.2

PREDICTED: Mus musculus exocyst complex component 2 (Exoc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Exoc2 (66482)
Length:
3669
CDS:
322..3201

Additional Resources:

NCBI RefSeq record:
XM_011244326.2
NBCI Gene record:
Exoc2 (66482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195832 CGCAGGCTACTTTGATTGGAA pLKO.1 2661 CDS 100% 3.000 4.200 N Exoc2 n/a
2 TRCN0000179234 GCCGAAGAGATAAAGAGATTA pLKO.1 2104 CDS 100% 13.200 9.240 N Exoc2 n/a
3 TRCN0000180377 GCCTGGTATCTCATAGAGAAT pLKO.1 823 CDS 100% 4.950 3.465 N Exoc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03652 pDONR223 100% 82.5% 88.3% None (many diffs) n/a
2 ccsbBroad304_03652 pLX_304 0% 82.5% 88.3% V5 (many diffs) n/a
3 TRCN0000478826 TGGTCAGTCATACAACAGGCAGAC pLX_317 15.2% 82.5% 88.3% V5 (many diffs) n/a
Download CSV