Transcript: Mouse XM_011244518.2

PREDICTED: Mus musculus RAS p21 protein activator 1 (Rasa1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasa1 (218397)
Length:
4358
CDS:
587..3262

Additional Resources:

NCBI RefSeq record:
XM_011244518.2
NBCI Gene record:
Rasa1 (218397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322308 ATGATGGGAGGCCGCTATTAT pLKO_005 1787 CDS 100% 15.000 12.000 N Rasa1 n/a
2 TRCN0000368862 GATGAAGCCACTACCCTATTT pLKO_005 2903 CDS 100% 13.200 10.560 N Rasa1 n/a
3 TRCN0000220600 CCTGACATCAATAGATTTGAA pLKO.1 2504 CDS 100% 5.625 4.500 N RASA1 n/a
4 TRCN0000322372 CAGATTGTTGAAGGCTATTAT pLKO_005 1847 CDS 100% 15.000 10.500 N Rasa1 n/a
5 TRCN0000322310 CTCAGACCTAATAGGTTATTA pLKO_005 1306 CDS 100% 15.000 10.500 N Rasa1 n/a
6 TRCN0000077655 CCTCCTGACATCAATAGATTT pLKO.1 2501 CDS 100% 13.200 9.240 N Rasa1 n/a
7 TRCN0000077654 GCAAGCAATCATGTGAGTTAA pLKO.1 3030 CDS 100% 13.200 9.240 N Rasa1 n/a
8 TRCN0000322311 GAAATCTGGAAGCTATCTTAT pLKO_005 1156 CDS 100% 13.200 7.920 N Rasa1 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 4030 3UTR 100% 4.050 2.025 Y Mtif2 n/a
10 TRCN0000220597 GCACACTAAATGACAGAGAAA pLKO.1 2871 CDS 100% 4.950 3.465 N RASA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01378 pDONR223 100% 77.1% 81% None (many diffs) n/a
2 ccsbBroad304_01378 pLX_304 0% 77.1% 81% V5 (many diffs) n/a
3 TRCN0000479196 GTAGGCAGTTAGTCTAGGGTTCCT pLX_317 13.3% 77.1% 81% V5 (many diffs) n/a
Download CSV