Transcript: Mouse XM_011245132.2

PREDICTED: Mus musculus exportin 7 (Xpo7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xpo7 (65246)
Length:
4540
CDS:
49..3195

Additional Resources:

NCBI RefSeq record:
XM_011245132.2
NBCI Gene record:
Xpo7 (65246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105414 GCGGATAGATATCCGGAACTA pLKO.1 150 CDS 100% 0.495 0.693 N Xpo7 n/a
2 TRCN0000324562 GCGGATAGATATCCGGAACTA pLKO_005 150 CDS 100% 0.495 0.693 N Xpo7 n/a
3 TRCN0000105410 CGACAGAGAATTGAGCCATTT pLKO.1 4065 3UTR 100% 10.800 8.640 N Xpo7 n/a
4 TRCN0000324563 CGACAGAGAATTGAGCCATTT pLKO_005 4065 3UTR 100% 10.800 8.640 N Xpo7 n/a
5 TRCN0000105411 CCCTGATGTTATCCGATTGAT pLKO.1 987 CDS 100% 5.625 4.500 N Xpo7 n/a
6 TRCN0000324564 CCCTGATGTTATCCGATTGAT pLKO_005 987 CDS 100% 5.625 4.500 N Xpo7 n/a
7 TRCN0000105412 CCTAAGAAACAGCATCGTCAA pLKO.1 2985 CDS 100% 4.050 2.835 N Xpo7 n/a
8 TRCN0000324487 CCTAAGAAACAGCATCGTCAA pLKO_005 2985 CDS 100% 4.050 2.835 N Xpo7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07832 pDONR223 100% 86.6% 93.4% None (many diffs) n/a
2 ccsbBroad304_07832 pLX_304 0% 86.6% 93.4% V5 (many diffs) n/a
3 TRCN0000471035 TGGCATCCTCGGCTAGACGCGCGA pLX_317 13.4% 86.6% 93.4% V5 (many diffs) n/a
Download CSV