Transcript: Mouse XM_011245692.2

PREDICTED: Mus musculus chromobox 7 (Cbx7), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cbx7 (52609)
Length:
4544
CDS:
1662..2255

Additional Resources:

NCBI RefSeq record:
XM_011245692.2
NBCI Gene record:
Cbx7 (52609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019145 GTATAGGAAGAGAGGTCCGAA pLKO.1 1703 CDS 100% 2.640 3.696 N CBX7 n/a
2 TRCN0000096733 CGTGACTGACATCACCGCCAA pLKO.1 2162 CDS 100% 0.720 1.008 N Cbx7 n/a
3 TRCN0000236359 ATAGGAAGAGAGGTCCGAAAC pLKO_005 1705 CDS 100% 6.000 4.200 N CBX7 n/a
4 TRCN0000096729 CCTGAATGTATTGGGAGGAAT pLKO.1 4348 3UTR 100% 4.950 3.465 N Cbx7 n/a
5 TRCN0000096731 CCTCAAGTGAAGTTACCGTGA pLKO.1 2146 CDS 100% 2.160 1.512 N Cbx7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07890 pDONR223 100% 69.8% 66.9% None (many diffs) n/a
2 ccsbBroad304_07890 pLX_304 0% 69.8% 66.9% V5 (many diffs) n/a
3 TRCN0000465729 AAACCAAGTACTCCTGGCATAGAG pLX_317 51.2% 69.8% 66.9% V5 (many diffs) n/a
Download CSV