Transcript: Mouse XM_011245728.1

PREDICTED: Mus musculus methyltransferase like 7A1 (Mettl7a1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl7a1 (70152)
Length:
1049
CDS:
104..706

Additional Resources:

NCBI RefSeq record:
XM_011245728.1
NBCI Gene record:
Mettl7a1 (70152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097560 CGTGATGTACAATGAGCAGAT pLKO.1 235 CDS 100% 4.050 2.835 N Mettl7a1 n/a
2 TRCN0000335663 CGTGATGTACAATGAGCAGAT pLKO_005 235 CDS 100% 4.050 2.835 N Mettl7a1 n/a
3 TRCN0000097563 CGGAGCCAACTTCAAGTTCTA pLKO.1 346 CDS 100% 4.950 2.970 N Mettl7a1 n/a
4 TRCN0000335664 CGGAGCCAACTTCAAGTTCTA pLKO_005 346 CDS 100% 4.950 2.970 N Mettl7a1 n/a
5 TRCN0000183893 CTTCAGCAATCTGCAGGAGTT pLKO.1 277 CDS 100% 4.050 2.025 Y Methig1 n/a
6 TRCN0000097562 CCCATGTTTCTGCTGAACCTT pLKO.1 155 CDS 100% 3.000 1.500 Y Mettl7a1 n/a
7 TRCN0000335743 CCCATGTTTCTGCTGAACCTT pLKO_005 155 CDS 100% 3.000 1.500 Y Mettl7a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.