Transcript: Mouse XM_011245826.2

PREDICTED: Mus musculus Eph receptor A6 (Epha6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epha6 (13840)
Length:
11234
CDS:
5508..6656

Additional Resources:

NCBI RefSeq record:
XM_011245826.2
NBCI Gene record:
Epha6 (13840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075776 CCATGGGACTCTTCTGTTTGA pLKO.1 11087 3UTR 100% 4.950 2.475 Y Atp5g1 n/a
2 TRCN0000318171 CCATGGGACTCTTCTGTTTGA pLKO_005 11087 3UTR 100% 4.950 2.475 Y Atp5g1 n/a
3 TRCN0000272114 GTCTAATCAGGCCTGTGTCTG pLKO_005 10796 3UTR 100% 4.050 2.025 Y Gm10039 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15300 pDONR223 0% 30.2% 30.1% None (many diffs) n/a
2 ccsbBroad304_15300 pLX_304 0% 30.2% 30.1% V5 (many diffs) n/a
Download CSV