Transcript: Mouse XM_011245991.1

PREDICTED: Mus musculus dexamethasone-induced transcript (Dexi), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dexi (58239)
Length:
2878
CDS:
433..720

Additional Resources:

NCBI RefSeq record:
XM_011245991.1
NBCI Gene record:
Dexi (58239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124180 CGCCTTCCTTATGGAATACAT pLKO.1 561 CDS 100% 5.625 4.500 N Dexi n/a
2 TRCN0000302437 CGCCTTCCTTATGGAATACAT pLKO_005 561 CDS 100% 5.625 4.500 N Dexi n/a
3 TRCN0000124182 CTTCGATGGATATTTGGAATA pLKO.1 699 CDS 100% 10.800 7.560 N Dexi n/a
4 TRCN0000335244 CTTCGATGGATATTTGGAATA pLKO_005 699 CDS 100% 10.800 7.560 N Dexi n/a
5 TRCN0000273626 CTGCTGCCCTCTATGTTCTAC pLKO_005 502 CDS 100% 4.950 3.465 N DEXI n/a
6 TRCN0000124183 GCTTGACGTCTTCGATGGATA pLKO.1 690 CDS 100% 4.950 3.465 N Dexi n/a
7 TRCN0000302440 GCTTGACGTCTTCGATGGATA pLKO_005 690 CDS 100% 4.950 3.465 N Dexi n/a
8 TRCN0000149370 GTTCTTCGTCAATGTGCTGAT pLKO.1 531 CDS 100% 4.050 2.835 N DEXI n/a
9 TRCN0000273625 GTTCTTCGTCAATGTGCTGAT pLKO_005 531 CDS 100% 4.050 2.835 N DEXI n/a
10 TRCN0000129347 CCTGTTCTTCGTCAATGTGCT pLKO.1 528 CDS 100% 2.640 1.848 N DEXI n/a
11 TRCN0000124181 GCTGATCCTTTACTACGCCTT pLKO.1 546 CDS 100% 2.160 1.512 N Dexi n/a
12 TRCN0000302503 GCTGATCCTTTACTACGCCTT pLKO_005 546 CDS 100% 2.160 1.512 N Dexi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03043 pDONR223 100% 90.8% 94.7% None (many diffs) n/a
2 ccsbBroad304_03043 pLX_304 0% 90.8% 94.7% V5 (many diffs) n/a
3 TRCN0000468584 CGATCCGATAACGGACCGGCAGTC pLX_317 100% 90.8% 94.7% V5 (many diffs) n/a
Download CSV