Transcript: Mouse XM_011246041.2

PREDICTED: Mus musculus PEST proteolytic signal containing nuclear protein (Pcnp), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcnp (76302)
Length:
2385
CDS:
225..701

Additional Resources:

NCBI RefSeq record:
XM_011246041.2
NBCI Gene record:
Pcnp (76302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241465 GAAGCTGTGGGAGCGAAATAT pLKO_005 641 CDS 100% 15.000 21.000 N Pcnp n/a
2 TRCN0000241464 GCGGGACCAAACTCCTTTAAT pLKO_005 591 CDS 100% 15.000 21.000 N Pcnp n/a
3 TRCN0000241461 TCCACGACCAAGACAATTAAG pLKO_005 682 CDS 100% 13.200 18.480 N Pcnp n/a
4 TRCN0000241463 ATTAGACTCGGAGCAAGTAAG pLKO_005 426 CDS 100% 10.800 15.120 N Pcnp n/a
5 TRCN0000241462 AGAAGCAGCCTGCGGATATTC pLKO_005 2077 3UTR 100% 13.200 9.240 N Pcnp n/a
6 TRCN0000330613 AGAAGCTGTGGGAGCGAAATA pLKO_005 640 CDS 100% 13.200 9.240 N PCNP n/a
7 TRCN0000141699 CCACCAGAACTTGAGGCAAAT pLKO.1 1484 3UTR 100% 10.800 7.560 N PCNP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15117 pDONR223 75% 76.5% 75% None (many diffs) n/a
2 ccsbBroadEn_12327 pDONR223 100% 52.3% 41% None (many diffs) n/a
3 ccsbBroad304_12327 pLX_304 0% 52.3% 41% V5 (many diffs) n/a
4 TRCN0000472449 TTCAGGAAAATAACCCAACGTCCT pLX_317 100% 52.3% 41% V5 (many diffs) n/a
Download CSV