Transcript: Mouse XM_011246322.2

PREDICTED: Mus musculus protein phosphatase 1B, magnesium dependent, beta isoform (Ppm1b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppm1b (19043)
Length:
2231
CDS:
57..1490

Additional Resources:

NCBI RefSeq record:
XM_011246322.2
NBCI Gene record:
Ppm1b (19043)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081122 CAGGATCACAAACCTTGTAAT pLKO.1 555 CDS 100% 13.200 10.560 N Ppm1b n/a
2 TRCN0000081015 CGAGATAACATGAGTGTTGTA pLKO.1 909 CDS 100% 4.950 3.960 N LOC433336 n/a
3 TRCN0000081119 CCATGTTATTGAAGCTGTTTA pLKO.1 1136 CDS 100% 13.200 9.240 N Ppm1b n/a
4 TRCN0000081121 GCAAGGATGGAGAGTAGAAAT pLKO.1 143 CDS 100% 13.200 9.240 N Ppm1b n/a
5 TRCN0000081120 CCAGGATCACAAACCTTGTAA pLKO.1 554 CDS 100% 5.625 3.938 N Ppm1b n/a
6 TRCN0000081014 GCCATGTTATTGAAGCTGTTT pLKO.1 1135 CDS 100% 4.950 3.465 N LOC433336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01255 pDONR223 100% 35.9% 34.6% None (many diffs) n/a
2 ccsbBroad304_01255 pLX_304 0% 35.9% 34.6% V5 (many diffs) n/a
3 TRCN0000479066 GCCTTGTTTCACATTTAGACTTAT pLX_317 66.4% 35.9% 34.6% V5 (many diffs) n/a
Download CSV