Transcript: Mouse XM_011246345.2

PREDICTED: Mus musculus GLTSCR1-like (Gltscr1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bicral (210982)
Length:
6338
CDS:
18..3440

Additional Resources:

NCBI RefSeq record:
XM_011246345.2
NBCI Gene record:
Bicral (210982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346736 GGCCATTGTTGTTCGTTAATT pLKO_005 3694 3UTR 100% 15.000 21.000 N Bicral n/a
2 TRCN0000346735 CCACGAACGCTGACCCTAAAT pLKO_005 370 CDS 100% 13.200 18.480 N Bicral n/a
3 TRCN0000346678 TAATCGGGTCCTTCGGTAATC pLKO_005 859 CDS 100% 10.800 15.120 N Bicral n/a
4 TRCN0000346734 GCCTTCCATGATGACTATAAA pLKO_005 881 CDS 100% 15.000 10.500 N Bicral n/a
5 TRCN0000346733 CACCATGTCCAGGCTATAAAC pLKO_005 1458 CDS 100% 13.200 9.240 N Bicral n/a
6 TRCN0000168006 CATCCTTTACTCAGGCTTCTA pLKO.1 655 CDS 100% 4.950 3.465 N BICRAL n/a
7 TRCN0000168820 CCGTTCCATTTAACAGCACAA pLKO.1 1051 CDS 100% 4.050 2.835 N BICRAL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02782 pDONR223 100% 80.6% 82.2% None (many diffs) n/a
2 ccsbBroad304_02782 pLX_304 0% 80.6% 82.2% V5 (many diffs) n/a
3 TRCN0000480900 CTATATCGACACCAGCGATAGCGC pLX_317 12.8% 80.6% 82.2% V5 (many diffs) n/a
Download CSV