Transcript: Mouse XM_011246415.2

PREDICTED: Mus musculus tetratricopeptide repeat domain 7 (Ttc7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc7 (225049)
Length:
3684
CDS:
603..1985

Additional Resources:

NCBI RefSeq record:
XM_011246415.2
NBCI Gene record:
Ttc7 (225049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196173 GCTGGGCACCTCTTAGATAAA pLKO.1 2257 3UTR 100% 13.200 18.480 N Ttc7 n/a
2 TRCN0000247470 CAAGGAGGCTCTCACCGTAAA pLKO_005 1712 CDS 100% 10.800 8.640 N Ttc7 n/a
3 TRCN0000247471 CCATGTCGGAATTAACCTTAA pLKO_005 1471 CDS 100% 10.800 8.640 N Ttc7 n/a
4 TRCN0000216241 CAGAATGCTTCAGCCATTTAT pLKO.1 540 5UTR 100% 15.000 10.500 N Ttc7 n/a
5 TRCN0000247469 GACATCCAAGTGACCATTTAT pLKO_005 2881 3UTR 100% 15.000 10.500 N Ttc7 n/a
6 TRCN0000247473 ACGCCCTGGACGTCATCAATA pLKO_005 1162 CDS 100% 13.200 9.240 N Ttc7 n/a
7 TRCN0000247472 ACTTTGCCACGGTAGTAATTG pLKO_005 820 CDS 100% 13.200 9.240 N Ttc7 n/a
8 TRCN0000184659 GCCACGGTAGTAATTGGTCTT pLKO.1 825 CDS 100% 4.050 2.835 N Ttc7 n/a
9 TRCN0000129208 CTGAAGTCCAAGCAAGATGAA pLKO.1 927 CDS 100% 4.950 2.970 N TTC7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12338 pDONR223 100% 79.5% 83.3% None (many diffs) n/a
2 ccsbBroad304_12338 pLX_304 0% 79.5% 83.3% V5 (many diffs) n/a
3 TRCN0000480913 CCACGCTACAAGCTGTTAGGAAGT pLX_317 26.4% 79.5% 83.3% V5 (many diffs) n/a
Download CSV