Transcript: Mouse XM_011246530.2

PREDICTED: Mus musculus spastin (Spast), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spast (50850)
Length:
4577
CDS:
743..1774

Additional Resources:

NCBI RefSeq record:
XM_011246530.2
NBCI Gene record:
Spast (50850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311200 GCCCATAGAACATCGCACTTC pLKO_005 1795 3UTR 100% 4.050 5.670 N Spast n/a
2 TRCN0000304960 CAATCTTGCTAACCTTATAAT pLKO_005 889 CDS 100% 15.000 12.000 N Spast n/a
3 TRCN0000421045 GATGAGAAATATTCGATTATC pLKO_005 1651 CDS 100% 13.200 10.560 N SPAST n/a
4 TRCN0000101591 CGTTTCATTAAACGGGTATAT pLKO.1 1418 CDS 100% 1.320 1.056 N Spast n/a
5 TRCN0000308338 CGTTTCATTAAACGGGTATAT pLKO_005 1418 CDS 100% 1.320 1.056 N Spast n/a
6 TRCN0000101594 CCCTTAACACATGCTAGTAAT pLKO.1 635 5UTR 100% 13.200 9.240 N Spast n/a
7 TRCN0000308404 CCCTTAACACATGCTAGTAAT pLKO_005 635 5UTR 100% 13.200 9.240 N Spast n/a
8 TRCN0000101593 CGAGAACTTCAACCATCTATA pLKO.1 1214 CDS 100% 13.200 7.920 N Spast n/a
9 TRCN0000308336 CGAGAACTTCAACCATCTATA pLKO_005 1214 CDS 100% 13.200 7.920 N Spast n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01585 pDONR223 100% 52.3% 57.3% None (many diffs) n/a
2 ccsbBroad304_01585 pLX_304 0% 52.3% 57.3% V5 (many diffs) n/a
3 TRCN0000478063 CTGGGAGATCTCTGGGCAATCGTG pLX_317 25.4% 52.3% 57.3% V5 (many diffs) n/a
Download CSV