Transcript: Mouse XM_011246967.2

PREDICTED: Mus musculus transmembrane protein 241 (Tmem241), transcript variant X20, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem241 (338363)
Length:
4378
CDS:
105..890

Additional Resources:

NCBI RefSeq record:
XM_011246967.2
NBCI Gene record:
Tmem241 (338363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191711 CCAGCAGTACTTAAACTATAT pLKO.1 794 CDS 100% 13.200 18.480 N Tmem241 n/a
2 TRCN0000192837 GTCGATGTTGCTGTTTGATAT pLKO.1 873 CDS 100% 13.200 18.480 N Tmem241 n/a
3 TRCN0000192330 CCATTGAACATGGGTAGATTA pLKO.1 1636 3UTR 100% 13.200 10.560 N Tmem241 n/a
4 TRCN0000201470 CCGTCTTATATGCTGAACCAT pLKO.1 1221 3UTR 100% 3.000 2.400 N Tmem241 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04470 pDONR223 100% 52.6% 48.8% None (many diffs) n/a
2 ccsbBroad304_04470 pLX_304 0% 52.6% 48.8% V5 (many diffs) n/a
3 TRCN0000475022 CACGAGTAATAAGGAGATGGGGTT pLX_317 55.4% 52.6% 48.8% V5 (many diffs) n/a
Download CSV