Transcript: Mouse XM_011246974.2

PREDICTED: Mus musculus arylsulfatase i (Arsi), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arsi (545260)
Length:
3627
CDS:
450..1889

Additional Resources:

NCBI RefSeq record:
XM_011246974.2
NBCI Gene record:
Arsi (545260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243671 GGCTCGCCTGGCTGATTATAA pLKO_005 1634 CDS 100% 15.000 10.500 N Arsi n/a
2 TRCN0000243673 CCAGGCTGTGTGGCTCTTTAA pLKO_005 1544 CDS 100% 13.200 9.240 N Arsi n/a
3 TRCN0000243672 TCAAGCGCTATGGTTTCTATA pLKO_005 1009 CDS 100% 13.200 9.240 N Arsi n/a
4 TRCN0000155219 GCCAGTACTCCACTATGCTTT pLKO.1 781 CDS 100% 4.950 2.970 N ARSI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10022 pDONR223 100% 73.3% 78.8% None (many diffs) n/a
2 ccsbBroad304_10022 pLX_304 0% 73.3% 78.8% V5 (many diffs) n/a
3 TRCN0000472957 AACTGGTAGATAGAATCCGCCCGC pLX_317 26.7% 73.3% 78.8% V5 (many diffs) n/a
Download CSV