Transcript: Mouse XM_011247296.2

PREDICTED: Mus musculus heparanase 2 (Hpse2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hpse2 (545291)
Length:
1215
CDS:
145..1152

Additional Resources:

NCBI RefSeq record:
XM_011247296.2
NBCI Gene record:
Hpse2 (545291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255772 ACTTACAGTAACCTCATATTA pLKO_005 730 CDS 100% 15.000 10.500 N Hpse2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08799 pDONR223 100% 53% 53.8% None (many diffs) n/a
2 ccsbBroad304_08799 pLX_304 0% 53% 53.8% V5 (many diffs) n/a
3 TRCN0000475450 ACTGCCGATATAGAACTCCATGTA pLX_317 23.1% 53% 53.8% V5 (many diffs) n/a
Download CSV