Transcript: Mouse XM_011247382.2

PREDICTED: Mus musculus tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 (Tnks2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnks2 (74493)
Length:
4058
CDS:
309..3011

Additional Resources:

NCBI RefSeq record:
XM_011247382.2
NBCI Gene record:
Tnks2 (74493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053239 GCTGCCAAGAAGGGTTGTTTA pLKO.1 2262 CDS 100% 13.200 10.560 N TNKS2 n/a
2 TRCN0000238899 ACCCAAATGCTCGGGATAATT pLKO_005 655 CDS 100% 15.000 10.500 N Tnks2 n/a
3 TRCN0000238901 CATTTGGCAGCTGGTTATAAT pLKO_005 2358 CDS 100% 15.000 10.500 N Tnks2 n/a
4 TRCN0000423098 GTGTCAATGCCACGGACAAAT pLKO_005 2518 CDS 100% 13.200 9.240 N TNKS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488738 AATGCTGACTGTTTTCTGTTTCAG pLX_317 11.8% 67.3% 64% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV