Transcript: Mouse XM_011247583.2

PREDICTED: Mus musculus CDC42 guanine nucleotide exchange factor (GEF) 9 (Arhgef9), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef9 (236915)
Length:
5527
CDS:
934..2484

Additional Resources:

NCBI RefSeq record:
XM_011247583.2
NBCI Gene record:
Arhgef9 (236915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226310 CAACCGGGAGTTGGCATTTAA pLKO_005 1002 CDS 100% 15.000 21.000 N Arhgef9 n/a
2 TRCN0000047613 CGCATTGACATGGATAAATAT pLKO.1 2026 CDS 100% 15.000 21.000 N ARHGEF9 n/a
3 TRCN0000226312 ACCACCACAGGACCCGTTAAA pLKO_005 2340 CDS 100% 13.200 18.480 N Arhgef9 n/a
4 TRCN0000226313 TACTTCTTGACCTAGATTAAG pLKO_005 4353 3UTR 100% 13.200 18.480 N Arhgef9 n/a
5 TRCN0000252487 GCCGCTATCAACACTTCTTTG pLKO_005 1577 CDS 100% 10.800 15.120 N Arhgef9 n/a
6 TRCN0000226311 ATCCGGAGAGACATCCTATAC pLKO_005 1996 CDS 100% 10.800 8.640 N Arhgef9 n/a
7 TRCN0000258240 GGCGCATTGACATGGATAAAT pLKO_005 2024 CDS 100% 15.000 10.500 N Arhgef9 n/a
8 TRCN0000258222 AGCGACGTCTGGAGAATATTG pLKO_005 1796 CDS 100% 13.200 9.240 N Arhgef9 n/a
9 TRCN0000218589 CAAGATGGATTCTGGATATAC pLKO_005 1495 CDS 100% 13.200 9.240 N Arhgef9 n/a
10 TRCN0000252488 GGTGATTTCTTCCCATATAAC pLKO_005 3354 3UTR 100% 13.200 9.240 N Arhgef9 n/a
11 TRCN0000258242 ATGTGACTCAGCAGATCAATG pLKO_005 1769 CDS 100% 10.800 7.560 N Arhgef9 n/a
12 TRCN0000047615 CCTCTGCAAGAAGGACCTAAT pLKO.1 1977 CDS 100% 10.800 7.560 N ARHGEF9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02740 pDONR223 100% 92.9% 98.4% None (many diffs) n/a
2 ccsbBroad304_02740 pLX_304 0% 92.9% 98.4% V5 (many diffs) n/a
3 TRCN0000471927 GCGTGCTCCTGAGGTACAGTGCCC pLX_317 31.3% 92.9% 98.4% V5 (many diffs) n/a
Download CSV