Construct: ORF TRCN0000471927
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016290.1_s317c1
- Derived from:
- ccsbBroadEn_02740
- DNA Barcode:
- GCGTGCTCCTGAGGTACAGTGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF9 (23229)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471927
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369030.1 | 100% | 100% | |
2 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_015185.3 | 100% | 100% | |
3 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_024452356.1 | 99.5% | 99.4% | 1_1delAinsATGACGT |
4 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369031.1 | 99.4% | 99.6% | 1_4delATGT;9_10insGTTG |
5 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369032.1 | 99.4% | 99.6% | 1_4delATGT;9_10insGTTG |
6 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_017029364.1 | 98.5% | 98.4% | 0_1insATG;2T>C;6_23del |
7 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353921.2 | 98.5% | 98% | 4_5delCAinsAC;8_28del |
8 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353923.1 | 97.2% | 96.9% | (many diffs) |
9 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001330495.2 | 95.9% | 95.9% | 0_1ins63 |
10 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369033.1 | 95.9% | 95.9% | 0_1ins63 |
11 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369034.1 | 95.9% | 95.9% | 0_1ins63 |
12 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369035.1 | 95.9% | 95.9% | 0_1ins63 |
13 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369036.1 | 95.9% | 95.9% | 0_1ins63 |
14 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369037.1 | 95.9% | 95.9% | 0_1ins63 |
15 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369038.1 | 95.9% | 95.9% | 0_1ins63 |
16 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_024452357.1 | 95.9% | 95.9% | 0_1ins63 |
17 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353928.2 | 91.4% | 91.4% | 922_923ins132 |
18 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353922.2 | 90.1% | 89.6% | 4_5delCAinsAC;8_28del;943_944ins132 |
19 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001173479.2 | 89.2% | 87.9% | (many diffs) |
20 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353926.2 | 88.2% | 87.7% | (many diffs) |
21 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369040.1 | 88.2% | 87.7% | (many diffs) |
22 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353924.2 | 88.1% | 87.7% | 0_1ins164;4_5delAC;8_9insTCCTGCCAGCTTTGTGAG |
23 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369039.1 | 88.1% | 87.7% | 0_1ins164;4_5delAC;8_9insTCCTGCCAGCTTTGTGAG |
24 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001353927.2 | 87.4% | 87.4% | 0_1ins63;859_860ins132 |
25 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369041.1 | 87.4% | 87.4% | 0_1ins63;859_860ins132 |
26 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001173480.2 | 80.2% | 80.2% | 0_1ins306 |
27 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369042.1 | 80.2% | 80.2% | 0_1ins306 |
28 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_017029374.2 | 79.6% | 79.2% | (many diffs) |
29 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_017029377.2 | 70.7% | 68.7% | 1055_1056ins244;1095_1096ins209 |
30 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_017029378.2 | 67.6% | 66.7% | (many diffs) |
31 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369043.1 | 66.6% | 64.7% | 0_1ins63;992_993ins244;1032_1033ins209 |
32 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369044.1 | 66.6% | 64.7% | 0_1ins63;992_993ins244;1032_1033ins209 |
33 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | NM_001369045.1 | 64.7% | 64.7% | 0_1ins414;508_509ins132 |
34 | human | 23229 | ARHGEF9 | Cdc42 guanine nucleotide ex... | XM_017029380.2 | 58.9% | 56.5% | (many diffs) |
35 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_011247582.2 | 93.4% | 98.8% | (many diffs) |
36 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | NM_001033329.3 | 92.9% | 98.4% | (many diffs) |
37 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_011247583.2 | 92.9% | 98.4% | (many diffs) |
38 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_006527992.3 | 92% | 96.9% | (many diffs) |
39 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | NM_001290384.1 | 89.3% | 94.7% | (many diffs) |
40 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | NM_001290385.1 | 89.3% | 94.7% | (many diffs) |
41 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_017318473.1 | 89.3% | 94.7% | (many diffs) |
42 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_017318474.1 | 84.9% | 88.4% | (many diffs) |
43 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_017318475.1 | 82.2% | 87.4% | (many diffs) |
44 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_017318476.1 | 81.7% | 87% | (many diffs) |
45 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_011247585.2 | 78.2% | 83.3% | (many diffs) |
46 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_017318477.1 | 78.2% | 83.3% | (many diffs) |
47 | mouse | 236915 | Arhgef9 | CDC42 guanine nucleotide ex... | XM_017318478.1 | 78.2% | 83.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1617
- ORF length:
- 1548
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacgttgctg atcactggag attccatcgt tagtgctgag gcagtatggg 121 atcacgtcac catggccaac cgggagttgg catttaaagc tggcgacgtc atcaaagtct 181 tggatgcttc caacaaggat tggtggtggg gccagatcga cgatgaggag ggatggtttc 241 ctgccagctt tgtgaggctc tgggtgaacc aggaggatga ggtggaggag gggcccagcg 301 atgtgcagaa cggacacctg gaccccaatt cagactgcct ctgtctgggg cggccactac 361 agaaccggga ccagatgcgg gccaatgtca tcaatgagat aatgagcact gagcgtcact 421 acatcaagca cctcaaggat atttgtgagg gctatctgaa gcagtgccgg aagagaaggg 481 acatgttcag tgacgagcaa ctgaaggtaa tctttgggaa cattgaagat atctacagat 541 ttcagatggg ctttgtgaga gacctggaga aacagtataa caatgatgac ccccacctca 601 gcgagatagg accctgcttc ctagagcacc aagatggatt ctggatatac tctgagtatt 661 gtaacaacca cctggatgct tgcatggagc tctccaaact gatgaaggac agccgctacc 721 agcacttctt tgaggcctgt cgcctcttgc agcagatgat tgacattgct atcgatggtt 781 tccttttgac tccagtgcag aagatctgca agtatccctt acagttggct gagctcctaa 841 agtatactgc ccaagaccac agtgactaca ggtatgtggc agctgctttg gctgtcatga 901 gaaatgtgac tcagcagatc aacgaacgca agcgacgttt agagaatatt gacaagattg 961 ctcagtggca ggcttctgtc ctagactggg agggcgagga catcctagac aggagctcgg 1021 agctgatcta cactggggag atggcctgga tctaccagcc ctacggccgc aaccagcagc 1081 gggtcttctt cctgtttgac caccagatgg tcctctgcaa gaaggaccta atccGGAGAG 1141 ACATCCTGTA CTACAAAGGC CGCATTGACA TGGATAAATA TGAGGTAGTT GACATTGAGG 1201 ATGGCAGAGA TGATGACTTC AATGTCAGCA TGAAGAATGC CTTTAAGCTT CACAACAAGG 1261 AGACTGAGGA GATACATCTG TTCTTTGCCA AGAAGCTGGA GGAAAAAATA CGCTGGCTCA 1321 GGGCTTTCAG AGAAGAGAGG AAAATGGTAC AGGAAGATGA AAAAATTGGC TTTGAAATTT 1381 CTGAAAACCA GAAGAGGCAG GCTGCAATGA CTGTGAGAAA AGTCCCTAAG CAAAAAGGTG 1441 TCAACTCTGC CCGCTCAGTT CCTCCTTCCT ACCCACCACC GCAGGACCCG TTAAACCACG 1501 GCCAGTACCT GGTCCCCGAC GGCATCGCTC AGTCGCAGGT CTTTGAGTTC ACCGAACCCA 1561 AGCGCAGCCA GTCACCATTC TGGCAAAACT TCAGCAGGTT AACCCCCTTC AAAAAATTGC 1621 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1681 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1741 ATATATCTTG TGGAAAGGAC GAGCGTGCTC CTGAGGTACA GTGCCCACGC GTTAAGTCga 1801 caatcaacct ctggattaca aaatttgtga aagatt