Transcript: Mouse XM_011247614.2

PREDICTED: Mus musculus ATPase, Ca++ transporting, plasma membrane 3 (Atp2b3), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp2b3 (320707)
Length:
6880
CDS:
433..3912

Additional Resources:

NCBI RefSeq record:
XM_011247614.2
NBCI Gene record:
Atp2b3 (320707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101553 CGAGGTCTTCAAAGCCGTATT pLKO.1 979 CDS 100% 10.800 15.120 N Atp2b3 n/a
2 TRCN0000101554 AGAAGTTTACTGTCATACGAA pLKO.1 1010 CDS 100% 3.000 4.200 N Atp2b3 n/a
3 TRCN0000101550 GAAATGACTAACATGGCTAAA pLKO.1 4331 3UTR 100% 10.800 7.560 N Atp2b3 n/a
4 TRCN0000101551 CGCAAGTCTATGAGCACAGTT pLKO.1 2128 CDS 100% 4.950 3.465 N Atp2b3 n/a
5 TRCN0000101552 GCCCAGGTCAAATATGGAGAT pLKO.1 1081 CDS 100% 4.050 2.835 N Atp2b3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4254 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13817 pDONR223 100% 65.1% 72.2% None (many diffs) n/a
2 ccsbBroad304_13817 pLX_304 0% 65.1% 72.2% V5 (many diffs) n/a
Download CSV