Transcript: Mouse XM_011247717.2

PREDICTED: Mus musculus dachshund 2 (Drosophila) (Dach2), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dach2 (93837)
Length:
1995
CDS:
203..1549

Additional Resources:

NCBI RefSeq record:
XM_011247717.2
NBCI Gene record:
Dach2 (93837)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436481 ATATCCATCATGGAGTTATTT pLKO_005 1609 3UTR 100% 15.000 21.000 N Dach2 n/a
2 TRCN0000108579 GATAAGATACAATCTCCACTT pLKO.1 344 CDS 100% 4.050 3.240 N Dach2 n/a
3 TRCN0000431313 TAATCTTTGTCCTGGTATTAG pLKO_005 1732 3UTR 100% 13.200 9.240 N Dach2 n/a
4 TRCN0000422179 TACTTGTGATTCCAGTATATC pLKO_005 1581 3UTR 100% 13.200 9.240 N Dach2 n/a
5 TRCN0000415375 AGACTCTGTTGACCAACATTC pLKO_005 1086 CDS 100% 10.800 7.560 N DACH2 n/a
6 TRCN0000108578 CCTCGCAGATGGATCATCATT pLKO.1 753 CDS 100% 5.625 3.938 N Dach2 n/a
7 TRCN0000020813 AGGAGGTAACTATTACTGTTT pLKO.1 1498 CDS 100% 4.950 3.465 N DACH2 n/a
8 TRCN0000108576 CCAACAATCGAGAAGAGCTTA pLKO.1 795 CDS 100% 4.950 3.465 N Dach2 n/a
9 TRCN0000020811 CCATTTATGATGATGCCTCAT pLKO.1 488 CDS 100% 4.050 2.835 N DACH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13061 pDONR223 100% 64.7% 66.4% None (many diffs) n/a
2 ccsbBroad304_13061 pLX_304 0% 64.7% 66.4% V5 (many diffs) n/a
3 TRCN0000473331 TGCTGATAAACTCCCGCTAAAGCA pLX_317 35.9% 64.7% 66.4% V5 (many diffs) n/a
Download CSV