Construct: ORF TRCN0000473331
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008208.1_s317c1
- Derived from:
- ccsbBroadEn_13061
- DNA Barcode:
- TGCTGATAAACTCCCGCTAAAGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DACH2 (117154)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473331
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 117154 | DACH2 | dachshund family transcript... | NM_001139515.1 | 91.7% | 91.3% | (many diffs) |
2 | human | 117154 | DACH2 | dachshund family transcript... | XM_017029255.2 | 76.3% | 73.9% | (many diffs) |
3 | human | 117154 | DACH2 | dachshund family transcript... | XM_017029254.2 | 75.1% | 72.7% | (many diffs) |
4 | human | 117154 | DACH2 | dachshund family transcript... | NM_053281.3 | 74.9% | 72.2% | (many diffs) |
5 | human | 117154 | DACH2 | dachshund family transcript... | NM_001139514.1 | 73.7% | 71.2% | (many diffs) |
6 | human | 117154 | DACH2 | dachshund family transcript... | XM_017029256.2 | 73.7% | 71.2% | (many diffs) |
7 | human | 117154 | DACH2 | dachshund family transcript... | XM_011530846.3 | 73.7% | 71% | (many diffs) |
8 | human | 117154 | DACH2 | dachshund family transcript... | XM_011530848.3 | 72.3% | 69.5% | (many diffs) |
9 | human | 117154 | DACH2 | dachshund family transcript... | XM_011530847.3 | 71.1% | 68.4% | (many diffs) |
10 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | NM_001289733.1 | 76.4% | 77.8% | (many diffs) |
11 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | NM_001289732.1 | 73.4% | 74.4% | (many diffs) |
12 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247716.1 | 73.4% | 74.4% | (many diffs) |
13 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_006528416.3 | 65.6% | 65.4% | (many diffs) |
14 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | NM_001289734.1 | 64.7% | 66.4% | (many diffs) |
15 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247717.2 | 64.7% | 66.4% | (many diffs) |
16 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247714.1 | 64.6% | 63.9% | (many diffs) |
17 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247715.1 | 64.6% | 63.9% | (many diffs) |
18 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | NM_033605.2 | 64.5% | 63.9% | (many diffs) |
19 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_006528413.3 | 63.5% | 63% | (many diffs) |
20 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | NM_001142570.1 | 63.3% | 63.2% | (many diffs) |
21 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247712.2 | 61.7% | 61.3% | (many diffs) |
22 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247711.2 | 61.6% | 60.9% | (many diffs) |
23 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247710.2 | 60.7% | 60% | (many diffs) |
24 | mouse | 93837 | Dach2 | dachshund 2 (Drosophila) | XM_011247713.2 | 58.6% | 57.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1464
- ORF length:
- 1395
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccagagttt cgctctgttg cccaggctgc agtgcagtgg tgtgatcttg 121 gctcgctgca acttccgcct cccaggttca agggattctt gtgcctcagc ctcccgagta 181 gctggaatta cagttcaaga cccggcaggc cccctaagcg ttctttggga gtgttgcagg 241 aaaatgcccg ccttctgacc catgcagtcc caggcctctt atcgccagga cttatcactc 301 cgacaggtat aacagctgca gcgatggctg aggcgatgaa acttcagaag atgaagctta 361 tggctatgaa cactcttcag ggaaatggaa gccaaaatgg gaccgaatca gagcctgatg 421 atcttaattc taacacaggt ggaagtgaat cctcctggga taaagataag atgcagtctc 481 catttgctgc acctggaccc caacatggaa ttgctcatgc agccctagct ggccagccag 541 gcattggggg tgctccaacc ctcaatccac tgcagcagaa ccacctgcta accaatagac 601 tggatctgcc atttatgatg atgcctcatc ccctacttcc agtcagctta cctcctgcat 661 cagttgccat ggcaatgaat cagatgaacc atctcaatac tattgccaac atggctgctg 721 cagcacagat tcacagtcca ctctccagag ctggtacctc tgttataaag gagcggatcc 781 cagagagtcc ttctcctgct ccttctctag aagagaatca tcgtcctggg agccagacct 841 cttcccacac cagcagcagt gtgtccagct ctccctctca gatggatcat catttggaaa 901 gaatggaaga ggtaccagtt caaattccaa taatgaagtc acccttggac aagatacagc 961 tgacTCCTGG GCAGGCATTG CCCGCTGGAT TCCCTGGACC ATTCATTTTT GCTGATAGTC 1021 TGTCCTCCGT GGAGACTCTG TTGACCAACA TTCAGGGTCT GCTGAAAGTT GCTTTGGATA 1081 ATGCTCGCAT CCAGGAGAAG CAGATTCAAC AAGAAAAGAA GGAGCTGCGA CTGGAGCTCT 1141 ATAGAGAGAG AGAAATTAGA GAAAACCTTG AAAGACAACT TGCAGTTGAG CTTCAAAGCA 1201 GAACTACTAT GCAAAAGCGC CTGAAGAAGG AGAAAAAAAC CAAGAGAAAA TTGCAGGAAG 1261 CCTTGGAATT TGAATCAAAG CGCCGGGAGC AAGTGGAGCA GGCACTTAAG CAAGCCACCA 1321 CTAGTGACAG TGGCCTGAGG ATGTTAAAAG ATACTGGAAT TCCAGATATT GAAATAGAAA 1381 ACAATGGGAC TCCTCATGAT AGTGCTGCTA TGCAAGGAGG TAACTATTAC TGTTTAGAAA 1441 TGGCACAACA GTTGTATTCA GCCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1501 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1561 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT GCTGATAAAC 1621 TCCCGCTAAA GCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1681 att