Transcript: Mouse XM_011247907.3

PREDICTED: Mus musculus calcium binding protein 39 (Cab39), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cab39 (12283)
Length:
3969
CDS:
705..1730

Additional Resources:

NCBI RefSeq record:
XM_011247907.3
NBCI Gene record:
Cab39 (12283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366824 GCTCTTAATTGTGGGATAATG pLKO_005 1122 CDS 100% 13.200 18.480 N Cab39 n/a
2 TRCN0000375639 TCTGCACCCAACAGAATATTT pLKO_005 1063 CDS 100% 15.000 10.500 N Cab39 n/a
3 TRCN0000366822 ACAAGTCTCCGGCAGATATTG pLKO_005 730 CDS 100% 13.200 9.240 N Cab39 n/a
4 TRCN0000375640 CTACTGCTAATCTGCTGTTAA pLKO_005 1817 3UTR 100% 13.200 9.240 N Cab39 n/a
5 TRCN0000366823 ACGACGAGAAGACCTACTTAG pLKO_005 1663 CDS 100% 10.800 7.560 N Cab39 n/a
6 TRCN0000375638 GCCTGAGAACCTCAAGCTAAT pLKO_005 1460 CDS 100% 10.800 7.560 N Cab39 n/a
7 TRCN0000110676 GCTACATTCAAGGATTTACTT pLKO.1 1260 CDS 100% 5.625 3.938 N Cab39 n/a
8 TRCN0000110677 CATTTGCTACATTCAAGGATT pLKO.1 1255 CDS 100% 4.950 3.465 N Cab39 n/a
9 TRCN0000110678 CGGCAGATATTGTGAAGAACT pLKO.1 739 CDS 100% 4.950 3.465 N Cab39 n/a
10 TRCN0000110679 GAAATTCTGTACGGCACCAAT pLKO.1 858 CDS 100% 4.950 3.465 N Cab39 n/a
11 TRCN0000044256 GCTACAGAAGAAGTTTCCAAA pLKO.1 819 CDS 100% 4.950 3.465 N CAB39 n/a
12 TRCN0000290761 GCTACAGAAGAAGTTTCCAAA pLKO_005 819 CDS 100% 4.950 3.465 N CAB39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03372 pDONR223 100% 92.4% 99.1% None (many diffs) n/a
2 ccsbBroad304_03372 pLX_304 0% 92.4% 99.1% V5 (many diffs) n/a
3 TRCN0000477461 CGGCTTTAAAAAGCCCGTCCCAAC pLX_317 38.7% 92.4% 99.1% V5 (many diffs) n/a
Download CSV