Transcript: Mouse XM_011248036.2

PREDICTED: Mus musculus leucine-rich repeat-containing G protein-coupled receptor 6 (Lgr6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lgr6 (329252)
Length:
6464
CDS:
147..2828

Additional Resources:

NCBI RefSeq record:
XM_011248036.2
NBCI Gene record:
Lgr6 (329252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239134 AGTCTGATGGAACCAAGTTTG pLKO_005 2680 CDS 100% 10.800 8.640 N Lgr6 n/a
2 TRCN0000239137 ACACTAGACCTGAACTATAAT pLKO_005 636 CDS 100% 15.000 10.500 N Lgr6 n/a
3 TRCN0000239138 TCTCAGATGTGGATCTTATTC pLKO_005 2542 CDS 100% 13.200 9.240 N Lgr6 n/a
4 TRCN0000239136 CCAATGATGGCTGCTTATAAA pLKO_005 2858 3UTR 100% 15.000 9.000 N Lgr6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08788 pDONR223 100% 84.1% 88.3% None (many diffs) n/a
2 ccsbBroad304_08788 pLX_304 0% 84.1% 88.3% V5 (many diffs) n/a
3 TRCN0000476522 CCCCTGTAATACTAGAGGTCCATA pLX_317 11.7% 84.1% 88.3% V5 (many diffs) n/a
4 TRCN0000488977 TTTGGGGCAATGTCTCGAAATCGT pLX_317 10.7% 84.1% 88.2% V5 (many diffs) n/a
5 TRCN0000488269 CTCCACATTCGCGACATTAACTCG pLX_317 12.4% 84.1% 88.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV