Transcript: Mouse XM_011248187.2

PREDICTED: Mus musculus rabphilin 3A (Rph3a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rph3a (19894)
Length:
3849
CDS:
126..2180

Additional Resources:

NCBI RefSeq record:
XM_011248187.2
NBCI Gene record:
Rph3a (19894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176046 GAGATCATCAACAGAGTGATT pLKO.1 279 CDS 100% 4.950 3.960 N Rph3a n/a
2 TRCN0000175064 CATTGGCAAGTCTAATGATTA pLKO.1 2024 CDS 100% 13.200 9.240 N Rph3a n/a
3 TRCN0000194157 GACATTGGCAAGTCTAATGAT pLKO.1 2022 CDS 100% 5.625 3.938 N Rph3a n/a
4 TRCN0000173192 CCATGACAAATCCAGAGGAAT pLKO.1 3240 3UTR 100% 4.950 3.465 N Rph3a n/a
5 TRCN0000193487 GTGTTTGAAGAACAAAGACAA pLKO.1 2105 CDS 100% 4.950 2.970 N Rph3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07812 pDONR223 100% 80.8% 85.9% None (many diffs) n/a
2 ccsbBroad304_07812 pLX_304 0% 80.8% 85.9% V5 (many diffs) n/a
3 TRCN0000477369 CAACTCGTGAATAAGATCATACCT pLX_317 16.1% 80.8% 85.9% V5 (many diffs) n/a
Download CSV