Transcript: Mouse XM_011248276.2

PREDICTED: Mus musculus AFG3-like AAA ATPase 1 (Afg3l1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Afg3l1 (114896)
Length:
2200
CDS:
97..2088

Additional Resources:

NCBI RefSeq record:
XM_011248276.2
NBCI Gene record:
Afg3l1 (114896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031212 TCCACTAATGTGGTAGTGTTA pLKO.1 1024 CDS 100% 0.495 0.693 N Afg3l1 n/a
2 TRCN0000031213 GAAACACTTCGTGCAGTATTA pLKO.1 219 CDS 100% 13.200 10.560 N Afg3l1 n/a
3 TRCN0000326059 GAAACACTTCGTGCAGTATTA pLKO_005 219 CDS 100% 13.200 10.560 N Afg3l1 n/a
4 TRCN0000031209 GCTTCACTGGTGCTGATATTT pLKO.1 1238 CDS 100% 15.000 10.500 N Afg3l1 n/a
5 TRCN0000325986 GCTTCACTGGTGCTGATATTT pLKO_005 1238 CDS 100% 15.000 10.500 N Afg3l1 n/a
6 TRCN0000031210 CCTGGTTAGCATCCTCCTATA pLKO.1 483 CDS 100% 10.800 7.560 N Afg3l1 n/a
7 TRCN0000325984 CCTGGTTAGCATCCTCCTATA pLKO_005 483 CDS 100% 10.800 7.560 N Afg3l1 n/a
8 TRCN0000031211 GCAGCTGTTCTTTGGTCAGAT pLKO.1 1599 CDS 100% 4.950 3.465 N Afg3l1 n/a
9 TRCN0000354080 GCAGCTGTTCTTTGGTCAGAT pLKO_005 1599 CDS 100% 4.950 3.465 N Afg3l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10220 pDONR223 100% 15.8% 11.6% None (many diffs) n/a
2 ccsbBroad304_10220 pLX_304 0% 15.8% 11.6% V5 (many diffs) n/a
Download CSV