Transcript: Mouse XM_011248284.2

PREDICTED: Mus musculus zinc finger homeobox 3 (Zfhx3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfhx3 (11906)
Length:
12917
CDS:
69..8495

Additional Resources:

NCBI RefSeq record:
XM_011248284.2
NBCI Gene record:
Zfhx3 (11906)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321358 ACCTATCTATGCCGGTGATTT pLKO_005 8686 3UTR 100% 13.200 18.480 N Zfhx3 n/a
2 TRCN0000075409 CCCGGACAATAAGCCGTTTAA pLKO.1 2123 CDS 100% 13.200 18.480 N Zfhx3 n/a
3 TRCN0000321285 CCGGACAATAAGCCGTTTAAG pLKO_005 2124 CDS 100% 13.200 18.480 N Zfhx3 n/a
4 TRCN0000321359 AGCGTTTGAGGACGACCATAA pLKO_005 5275 CDS 100% 10.800 7.560 N Zfhx3 n/a
5 TRCN0000075411 CCGGAAGAAGTTAGCGGATAT pLKO.1 2489 CDS 100% 10.800 7.560 N Zfhx3 n/a
6 TRCN0000013562 CCTTGCACAAACACAGAACAA pLKO.1 8035 CDS 100% 4.950 3.465 N ZFHX3 n/a
7 TRCN0000075408 GCCAGGAAGAATTACGAGAAT pLKO.1 4233 CDS 100% 4.950 3.465 N Zfhx3 n/a
8 TRCN0000075412 GCCATGCTCTTAGACTGTGAT pLKO.1 5595 CDS 100% 4.950 3.465 N Zfhx3 n/a
9 TRCN0000321289 TCTCGCACCTGCACAAGTTAA pLKO_005 2053 CDS 100% 13.200 7.920 N Zfhx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10687 pDONR223 100% 27.8% 29.5% None (many diffs) n/a
2 ccsbBroad304_10687 pLX_304 0% 27.8% 29.5% V5 (many diffs) n/a
3 TRCN0000468237 TGCGAAGATACCACGCCATCGAGC pLX_317 5.8% 27.8% 29.5% V5 (many diffs) n/a
Download CSV